Description :
From Genome Similarity Track
Location :
contig_47:270839- 280073
Transcript NameFunction/comments
g9231.t1XP_009523373.1 hypothetical protein PHYSODRAFT_298687 [Phytophthora sojae
g9232.t1XP_008890386.1 hypothetical protein PPTG_00692 [Phytophthora parasitica INRA-310
g9233.t1hypothetical protein
g9234.t1hypothetical protein

Sequence
9234 bases(100 bases per row)
TCTCGCCCGAACAAGCGAACCGAGGAATGGCGAGAGCGACTGCAACGCGCACGCGCACGCGTGCCGCCAAGGCGCCCGCCGCGGAAAAGAAGCGTCGCCG
GGCGCCGTCGGACTCTTCCTCCGACGATGAGCAGGAGCTTGAACTGAGTGACACGCGCCGCGGCCGGGGCAAGCGGCAGAAGGCCAGCGCCATCCTGACC
GAGTTCACGAGTCTGGACGCGCTGCTGAGCAACGACCTGGCGGAGAAGCGCAAGCGCCAGAACCGCGAGCGCAAGCTGCAGAAGCTGCGCGAGGAGAGCG
AGGCTGCGGCCAGAGACGCGTCCGAGGGCGGCTCCTCGCCGCTGGGGAAGCTCATGAGCCACATGGCCAGCAACATGTCCACGCTCTCGGGCGACAGCCA
CCTGTTCTTGGGCTCGGAGGTGACGGTAGCCGAAGAGAAGTTCGGCTACGTATTTACGCCCATTACAGAGGTGGGTGGGGGCACTGAAGGGCTCGTGACG
GGATGATGTATTGACAAAAAGTGTTTTTTACGGAGTAGCCTCTGCCGTATCGCACGTACAAGGCGACGGAGACGGAGCTCAAGAGCGACCTTAAGCTCGT
GTACGCGGTCATGCAATCCACGGACGACGCAGAGCTGAGCGGACTGCTGTGGTCCAAAGCCATTTTGATCCGCTGCATGCTCACGCAGCCGACTAAATCG
ACCACCAGAACTGCTGCACCCACCGACACCGGTGGCGCTGCCATCAAAGATAGGATCGTGGTTATTTATGACGAGTAGGCTTGTTGTGATGCCCGTGAGA
AGGAAATGTCGGCTGCCGGCTCTAACGAGTGCTCCTTGATTTGCTTGTGCAGTGTCGACGCATAGCGACAGTCACGTGGTTAGCGGATGCTTTAGCAATC
TCTTTCTGATGCTGAGCTCGGTCAACAAGGCGTCCATTCCGAGATTGAGCGCAGCTCTACCCGTTGCGTGTTTTGCCCACCCAATTGAGGATTTCCGCTC
GGCTTTTGGCACCCAGGTCCCAGCAATTGAAATGGAGTGGAAGCCGACCATCTACGATTTCCTCAATGCCTTCCGCGCGTATGGTTTTCAAGACAGTAAG
CGATCCATGAGTGTGAAAAGCAAGATCCCGGCGACCCCGCCGTCGACGAAGAAATTGCGCGTACTGCCTTTCCCGACCCTCAATATGCATTACGTGCTGA
TGTACTTGGTGATCTGTCTGTTTGCGCACGAAAACACTGACGCTGGAGGGCTACGATGCCTTCAGTTTCACGATGTTTTTTTTGCGTATGCAGTTTGAAA
ACGATATCCACGCCAGTATTGTAGACCTGGCCACCATTTGCATTGAAGAACTCCTGGATGTGTTCCCGCGCGCCGAGTGGCGGAGAGAGTGGGCGCCGCA
GCTTGTTCTCCGCATCGCTGGGGCCAACGAAGGCTTGTTTGACTCGGCAGCTGGCTGGCTCGCAGTTGCACGTCGACTTCCGCGCACAATGCGTGGCACA
CAACTCACCACAGGACTGTCGATCTACGTCCTGCAGCACCGAATCGACATAAAGCTACTGGAGGGGGTACGCTAGATTGTGCTCCTGGTACCCTGTTGTG
TGTCGCAGTCGCTAATGTTGATTTTTATGATCGTTTTGGATATACAGGCAACGTCCGAGAGGCCGTTAAAGTTTCCGATCCAGAGTGGACTTGTGGTGGA
CATCGTTGCTGGTATTGTGCAAGATTTGACACTGAAGTATGCGGAAACGCGCAAGAACGGCAAGTTATCGAAAACCACGCCGCCGTTTGATCTGCTGTGC
AAGAAGGTGGCCCTGATGGACCTTGCACTACAGGCATTCCTCAACATCCTCACACCAAAAGAAATGAAAATCATGCTGAACAAGCTGGACCAGCTGGCTG
ACGCACACAAATCGACCATGTCAGCCAAGTGGCACGAGCTCAAGACACTTGTAAGTCTCATGCACCGCAAGTACTCGCTTGAAAATTTGCGCATAGGTCG
GAGTTCTGCTCCTTCAGCGAAAACCGAGCTGTTTTGTGACGACGACGATGAGTAACAACATTTAGGGACGTTTGTTGAGTCGCAATGCGGCTGAATAGAG
ATTAACTGAGCACTGGAGCTTGTTATCGCCCTATGCGCGGTCGCACCGTGCGAGCTAGTGGCGCTGCGGTTTTTATCTTAGTATGCTGCCTCAATTGTGC
GATCACCTACAAACTCATCAAACTATTGCTGCTCTTGGACCAGTGCTGCGTACTGCTTCTGCAATTTGACCTCGATTAGCTGTTGCGAGTTCACTTCGTT
TGCCAGTCGGGACATACGGCTTTGCAGCGCCTGGGCTTCGACACTTGCCAGATCCTCGAAGCACGCCTGCTCGATCGTAGCGTTCTGAAGCTCAGTCATG
TGGCTGCGCAATGACTGCAAACCCTGTTCCGAGCGGCGGTAAAATCCACCATTTACGACCCGCGCCCGCTCGCCCAGCTTCTGCGCTCGCTTGGCAAGGA
ACTGCTCGGTTTCCTTCAACTCCGCAAAGCGAGCTCGCACGGCATGCAACTTGTCCTCGTCTGATGTAGCAAATTGGAACGACACACCACCGTTTGTACC
TTCGCCGTCAGCTTTGCGTAAATAACGCGCTTGCACTTCCTCCCATTTAGCGCCGAGAATCGAGGCGTCCTGAGATTTCCACACGTTGTTCACGCCACAC
AGACTGGCCTCGATCTGCACCATTTGCCGCGCGTGCTCCATATCACTGTCCGAGAACTGCTGTAAATGCGGCACTGCCACTGCGCTCGGAGATTTTTTGC
GCTTCTTGCTCTTCTTGGACTTGCCATCATCTATGGGATACTTGGCACGATCATGCTCAAGCATTCGGTACATTTCGTCCGCTACCTCGGTTATTGCGCT
GTGAATCAACACCTTTTTCACCTTTGTAGGACGAGGAAGATCCTTTTGCACAGCAGATGAACGCCGTTTAAGTTCACGCTCTTTTTCCTGCTCGCGCTGC
TGCTGCTCACGAGCCTCTCGCTCCCCAGCATCTTCCTCCTGAAGGCCAGTGACGCGGTCATCGTCAGCTTCCTCCTTCTCCGGAACATTAATTTCATATT
CATTCTGAGGCGCGGGTAAGCTGTTGAAACCTTGACGCAGACTGGCTGCCAGTCGCTTTGCCCGAGCCTTTTCTGCCTTGGTATTCTCAGCCTCTGTACC
ATAGAGTTGCTCCGGGTTGATGCCTAACTCATCACGCAGTGGTGTGCGTGTGGCAGACAGAGGCGTCTTGTCACCGACTCCACCAGCCATTGCTGAGGAT
GGTGTCCGGGACGGAGTAGCACCCGCATAGCCTGTTCCTTCGTAAAGCTCAACATTCTCGCCGCCAAGAAGAGGAGTAGCACTGTTTCGCATGGCCAGCA
GATTGGCGGTTTCCTGCATAATATTATCGTGCACGTCGCGACTTGATGGCGTAGCTGCAGGGCCTCCAGTAGCGGGATGAAGCGGGGTGGCACTGTAGTC
ACCCATAAGCGAACGCGTCTCGGTAGCTGATCCGTTCTCCAACGCAAGCGCAGCTGCATGGGTAGCGTGCATCCCCAACTTAGCGAGGTCGCTCAGCTCC
TCGTTCGAAACCACAGGTGCGGGCAGCTCCAGCGGAGTGCGCTTAATCGCGTTGATGGGGTCGTTCTTCTCGTTCACCGCAGCGATAATCTGTGGCAGGT
TGGATTTCATCAGCGATTTTTGTCTCTTGGCATCCTGTTTGCGCTCCTTCTTCTCTTGAGCGTCACGGCGCACGCCTTCCAGCTTGTCCAGCTGCAGTGC
CGCCCGCTTCGGGTCCAGGCCATTGCTGGAGATGCGCTTCTCCTCCGCGACATCGTAAAACCCAGCGGGGGCCTTCTTCTCGAATGGGATCTCGCTCGCG
TAGTCAATGTACTTGCGCTTCTTCATGTGCACCTTCGGGTTGGACGACATGACTCCGGCAGCCTTGAGTTCGCGCTTCTTCTGCAGCGTAGCGAGGCGTC
GCGCCTCCTCCAGCTGTTTCTCGCGGGCCTTGCGCTTGGCCTTCTTGCCCTTGGTGTTGGCCAACCGAGCCCTCGCCTCCGACAGCATCTCCTTCTCGTC
TTCGTCCATGTCCACAGGATCGGGTCTGGCCGGTTTGTTCTCCGGATTGGGGTCGATCTCCCCGGCGCGCAACCGCCGCGGGTCGTCGCTCACGTCGACG
CCGTCTTTGTGTTGCGCGGCGTCCAGCAGCCGCTCGTAGTGCTCCATGCACTGCGCCGCGGTGCGGCCCACGATGGGGGCGATGGTGCGCCACTGGGAGG
GCATGAGTTTGACCAGATGCAACAGCTTCTCCTCCTCCTCACGGCTCCACTCGGTCTTCCGGATGCTTGGGTCCAGCCACTCGTACCAGCGCGCCTTGCA
CTGCTTAGCCGACTTGCGCGACAGCAGCGACGCCACGCGCGCCCACTGGTTCATGCCGTACTTCATGACGGCCGCCTTGAGGATCTCATCCTCCGTGTTC
TTCCACACGCCGCCCTTGATCATGATCCGCATGGCTGCCTGCGGGGGGAGGCAGCGACAGCGACGGATAATGGAGCGAAACGAGTGGTGTGCGCACATCA
CATCGTATCGTGTATAGTTGATGTGGTACGTATCTTTTCGTATTGAAGTTGTCATGGCGACGATGGAGCAGCGAGGGCGCAGTCTGCAGGCGGCGCTGCA
GTTCATGGAGCGCAATGGACGCGCGCTGGAGGAGCTGGTGGCTAGGATGTTGAAGGCACGTGAGGAGCAGGAGACCTTCCTGGGCGCGTTCGCCAAGAGT
CTGGAGGATATCGCGGCCCAGGAGGAGTGCACGCCGCTGGCGCAGGTACTGGAGAGTCTGGGCGACTGTGGGCAGAAGCTGGCGAGCGAGAGCCACGACA
TTATGATGCTGCGACCCGAGACGGAGATTTTACAGGTGGTCACGCAGATTCAGGACTGGGCTATTGTGCCCATGAAGGTGCGGGGCCTGAAGAGCTCGAA
GGAGGGTAGAAGAGAGAGAGAGAGAGAGAGGGGTCTGACACTTTGGACTACTGCAGAGACTGCTGGAAGACCGGGAGAAGGCAATCAAGATTGAAGCCAA
ACTACAGAAGGAGTATGACGAGATGAGAGTATGTGGGAGAGCTGTGGAGACAACGGTAATGCAGGTCAGACACTAATGTATTGGTGTCTTTGTCCTGGTT
GAAGCGAGGAAGCTCGGCAAGAGAGAAGAAGCTGCGGATGCTATCGGACCAGAAACGGCGAGTAGAGAATGTCAACGCACTGCTGGAGACACACATGGAG
AGCTTCGACCGGTATCGAATTCAAAAGATGAAAGTGCGTTGGTATCGCCTCTCAGCTACCGCTCTCGCTAACCTGCTAACCACTCTAAAATCTACTACTT
CGCAGAAAATTGTGAGCGAGTTGGCTCGCTCTCAGGTATTCTACCATGCCAAAGGACTGGAGTTATTTGCCGTTCCGTGTCAAACCATCGCTAAGCTCGA
TCCCTTAGACGCAATGAAGGCCACTGCACAATCCAACCTACCGATGCTACCTAGATGGGTCGGACAAGCAGAACTTTGGTAGCATCTCGGTACCAATCGT
AAGCATTTCATTACCTGTATTATCCTTGTCTTGCTAATCGAATATGTACAGCGCGACGTAGCTAGATTGCTGAGGAGCGGCCTCTTTCTCGCTCCTTTCT
GCGCTTGCTGTGGCCGAGCTTCGCCATGCTCTCTTGCAACTTTCGCCAAAACGACCCCCTCTCGCTTGGTGTTCGCTGTGGGCTCTCCGTGCCAATACCA
AATTGTTGGCGCCGTGAGATTCCAGGCGATGCTGTCCAACTTTGCGGAGAATAGCAGTAGTCCTCCAGCAGCTTGTCGCTGTAGAAACCTCGTTTCTGCG
TCATGAAGTGTTTGATCAGTCAGGAGTACATAATTCCACAAGCACAAGTCGGTCACGCACCTCTTCGAATTTCTCGTAAACCAAGTGCACAGGCACATCT
AAGTAATTCGCCAGTCCGAGCTGCAAGCTGCAAAGTACGCATGCAAAGCATATTGTTAGCTGTTGTACCGATCCAATTGCACCCAGATCAGCCTGGCGGA
TACCTCATTTGCACCGGCTGAAGAGATATTTGTCGTCGAGAAAACGTGGGGGTCGCTTGGGACACAAAGGATACACCGTAGTCCGACTGCATTTTAAACA
GTCAAATTGATGAGCCCGCCTGGAATTCCACTCCCAACATATACCCACGTCCCATCAAACTGACCTGTGGCTGGTGCGAGAACTTCACGGAGTGCTCGTA
CATGTGTCGATAGACAGCATCTCCTAAAGATTCAAGCTCGCTGCCGCGTTCCTCGCAAAGTTGCACTCTATCAATGAACGATGTCCACTGTTGAAGACAA
AGTGTACGTTACAAAGTGCGACGTCACAAAGACCCATACCGGGGTACCCGGTTTGATACTACCACAGCAAGTTTCATTCTGCACGCACCTCGGCGAGAGT
TTCTTCAGCGGTGTATTTGCGAATAAATGGATGTTGGAGCAACGCTTCAGCTGACGGTCTGTCGTCTGGGTCAATCGTAAGGCACTACACTCATACCCAA
TGGGTACCAGTCAGTATACACACCAAGCACAAGGCTTGCAAAAATGAACGAACCTGATCGGTGAACGAGCGGCATTCTTCAGAGTATGCTTCAGCCGGCA
ACTTCAGGCATTGTTCGTTTGCAACCTGAAAGGGTGTCAGTCTATGTTGTGAGTACGCAAGTAGGAAAAGAAGGCTGGACTAAAGAGAAAACTCACGGAA
TCAACCAAGCCGAAAAATCCGTCCTGCGTCGGAAGCGGATAGCGGCCCAGAGCAACAGATATTAAGGCGAGTCCAAAAGACCAAACATCGGCTACAAAAA
CAACAACAAGACAGAAAATTCGTGAGCACGCTGTGACTAGGGGCCACATCCCACGCACGACTCACCAGGATAAGAGTAATCACCGCCACCTATCCGCTCG
GGTGCCATGTAAAGTAGAGTACCCACAAATGTCTTCGTTGTGGTGGAGGAATCATTCAGCGTACGAGCCAAACCAAAGTCCGAAATTTTGACATCGCCTT
CTCGGTTTGTCAGCAAATTGTGCGGCTTAATGTCGCGGTGTACCATCCGCTTGTTGTGAATATGAGCTAACCCATGTAAGACGCCCGACGCCAAGCGTGC
TAGAACCTTTTCGTTTTGGCAGCCACCACGCAGAACAATATCTTGCAGTGACCCCGTGCTCATGTACTCCATAACCATGCAAATTGAGTTTTTTGGGCGA
TCGACAAACGCATCGTAAAATGACACGATGTAAGGGCTGGGCCTGGAATATATAAAATAACAAAGCCCTGTTAGTAAAACACGCACAAGCGTATTCTGGG
GAAAGCAAGCATATTCGCCAGGTAAGACACATACTTCGCCTTGGGCTTGTTGGGGCTGTTTCCGGGGGTATCGTGATACGGCATGGGGCTGTCGTTACTT
CCCATGGGAACCAGATTAGAGTACAATGCATGCAGCTCGCGCACCATTTGCCGGCGTTGCCCTCGTCCGTACACAGGAACATCCTGTATCCCATATTTAC
AATATAAGCACAAAGTGGATTTAGCAACAAGACCAACTGTAGGCAGAGCACATCGTAAGAACTCACCTTGACAGCGACCACTTTCAGCGTGGGAATGTGA
ATGGCCTTATAAACTACCCCGGAGGCTCCTCTACCAATTTCTTTAACACGCTCGAGATTTTCTTGCAGATGCAGGCATGCAGCATCCGGTGATGAAATAC
CCGCTTCCGACACTGCCACATTCTTGGTCGTAAACATGCCATGATTCGGTGAATACGCACTCCCAGCACTATGCCGCCCACCATCTACAGTACATCATTA
AATTTAAAGTCAACAGAAGTGAAGCATCAATAGTTAGCAGCGCCCGACTCAAAAGTCACAAATCGCATGCGGACCGCACCGTTTGGAGATTGAAGGTCCG
ACTCTGAGCCGGAACTGAAATTTAGTTTCATCATCGCCTGCTGTGCGGCGCTAGGGCCACTCACAGGAGTATTCGATCCCGACGCAGCTGCAGCAGCAAT
TGCAGCTGCCTCCATAGCATCTCGTTTCGCAATAAGCCTAGTAGCTGCTCGCTGAGCCCGCTCCTCCGCTTGCTGGGGTGTGGGCATATCTTCAAGTTTG
AGTCGAAGCTGGGGCCGCTTGCCTGCACGGGCACTACCTGGGGTCCTCTTAGCAGACTCTACGGTTTTCCATTGCGGTGAGCTATCGCGAGGAGTAGATA
CTGGTGGCGGTGTACCTGTGGACGAAGGCGATTGCGCCTGTTTTACCGGCGACAGTGGTTGAGGCCGTTTATCTTCGAGAGTGAGTTGGTTCGCTAGCGC
ATCAATTTCTTTGTCCAGTTCGGTCACAGTATGGTCGGCATTCTTCTCCGTAGCAGCACCATTAGTCTGATGGTAGCCAATGCTACGAGCCGATTTCGGC
GCTGGAACGGAAGCATCGCCGCGTGGACGAGCAGATGCCGATGTGATTTTTGCAGCCTGCGAGAGCGATTCCCCTTTGTGCGGCTGCTCCAGCAACTCGG
TCGTCTCCAGAGAAACCAGAAAATCCTTGTCCATCCACGGACACTCCCACGACTTGACCTCTGCAATCCGCAGTTCTCGCGGGCAAATATCCGGGAAAAT
GCGTGCGATCACCTCGTCGTCCGCCTATCAACAGAGCAACAAGACACCACATAAGTCCACATCTCCTCAGTAGCTGAACATTCTCCTCCGGCACCTGCTT
GGTGAGACTCGGCGCCGATTGCGGTCGCATCAGCGTGTTCTTGTGCACGAGGAATGTCGCATGGTGCGGCGCCCGACCCGCCCGCAGCAGGATGGGACTG
GCGCCGTCCGCTGTGTTGGCGAAGGGTGAGCTGTTGGATTGCAGAGTCGTGTTGGCGGCCGCCCGCTCGCGACTCTCACGGCCCTCGTAGTTGGCGCTCT
CCACGCGGCCGCGCTTGCGGAATCTCTCGAGGAGCGTCTGGCGCGAGACCTCCTCGATGGAGCCGCTCAGCAGGTCGCGGCGGTGGCTGGAGGAGCTGCT
GCTGCTGGAGGCCGCTGACGGAGGCGACGTCTCGCGCTGCGCCGCGGGCTTGGACACGTGCCGGTTCTTCTTCATCGTGAGCTGCTCCGGCATTTGACTT
GCTGCTTACGATCAAGCCCAGGAAGTGTATCCCC