Description :
From Genome Similarity Track
Location :
scaffold_1312:2708- 4043
Transcript NameFunction/comments
g11282.t1hypothetical protein

Sequence
1335 bases(100 bases per row)
AGAACAGCAACACAACGCCCAGTGGCTTGCCGATGACGCTTCACGTGTTGCGCGCTCAATAGGTGCTACGGTGTCTGGAATGGTGACGGACAATGCGAAC
GCCAACAAAAAGTCATGGAGACTACTCGAGAAAGAGTTTCCAGATAAATGTTTTCATGGCTGTGTCGCTCACGGATTACATCTTCTCGTCATAGATATTT
TTGGAGCAAAAGAAAAAGTGCGTGTGGTGAATCAGGAGCCGCAATACCCAGTTCGCTGCGTGGCGCTACTAGGATGACAAAACCGCACAACCGATGTGAT
AAAGAGGCCAACAAATGTCTTTGTTTACGCGAATCCCACGTCAACTTTCCTGACGGGCCCCACGGCGCGGCAAAGACGTTGTCAGCGTTGTTTTATAAAG
CGACGCTTGGGGCTGAGTTCAAGTAGTACTAAGTAGTACTATCCAGTAGTTTGAGAAACTACTAGTTACTGCTGTAGGATAAGACTATTTAGTCCGGACA
CTACAACCCTATTTCTAACTCTCAACCAATAGCAATGGTTGGAATCGTCTTTATGGCCAATCAAACTTCGTTATGGGTAGGGTAAGTTCGTTCTAGCTTA
TTTTCCGTAATTGTCCGGAATTGTGTTGTCTTATCAAATAAGAGACTTTAGTGAAGTCAATACAAATACCGGCTTATCGGATTAATGCATTTTGTAACGG
AACAATGCGTTCCGTACACGCTTCTTATTCTTTCCTGGCCCTTGAGCGGTGGGCTAGTACTCCAGGTCAACTAGGGACTCGTTACCAGACACCTGGTCTG
TCTGGTATCCCTGTTCCTTTCACGCACCACCCTCTAATATAGAGGGAAATAAACCAATACAATCGGTTATAAACAACAGTCTAGTATGCACTCTGAAAAC
GACTGTCTAGTTTCCAGAGTCTGTCCAAACGAGCAATATGAAATGGGCTACCCTTAGAGACAAGACAAACGACCCAACTATTAAATGGAATAGGCGGGTC
CTCTTAGGTCTCTATGTTACGCTGATCACCACCTAAGGGGCTGAAGGTGGAGATCACACAGCGCTCGTCCTCGACGCAGTGGCCTTACACTTCCTAAGAA
TCGACGAGTCTACCTCTGGATTATACCGCAAATTGAACCCTTTATTAAGGAATGTTATATGGCCATTATCTTCTGAGGGGAGAGCCTAATAAGGCATCGT
GATAAACACAGCACAAATCACGTGGTAATCCGGTATTCTTTCTTCGGAGACACTTCCACGCCCACTTGCACGAGCACTTCCAGACGCGCAGCTTCCATCC
CATGGTAATCCGGTATTCTTTCATCGGAAACACTT