Description :
From Genome Similarity Track
Location :
Scaffold_219:27076- 33781
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_219-snap-gene-0.23Glycosyltransferase

Sequence
6705 bases(100 bases per row)
GGCGCGCCACCTGCCGGAGACTCGAACATTTGGTAATTGTTGCCACGGCTGCTGCCATTGTTGTTACCGCCGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGGTTGCGGGCGCTACCAGGGGTGCGCAGACCGCGACTCTCGGCACGAGCGCGCTGGGCCTTTTCGCGATCCACT
TCGGCTTCACGCTTCGTACAGATCACACCATTCTTCTTCGTGCCAGCGCCGACCAGAAGAACCATCGTAACCAGACAGAAGCCAGCCAATGCGTACAAGT
ACAAGTACTCGTTCTTGGATAGTGATTCGTCTGCGTGCATGAACACGTACCCCAGCGGTGCAATGAAGAAGAGCGCAAAGAGGAACGTCGTTGACGAAGC
ACGGCCACGGGTGTTAAACATGCCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGTACAT
CAGCATGACAATCATACTGTAGTACAAGCCAGCGTTGCTCAGATCATTCAAAAAGCCAGAGCTCTCGTTGAAGCCCAAGACGCCAGCGCAGAGAGCTACT
GGAATCAGCGTGCCAAATAGCACCGACTTGTGGTCCAGCTTGTCGATAAAGAAGAACGACAAGAAGGAACCAGTCAGCTGCAATGCCACCGAGTTCACAA
ACATGTGCGTTTCGTCTTTCAAGATGCTGGACGACGTCACCTCGGAGATCACAAAGGAGTTCAAGAAGCACGTAGACAGCGACGACACCAGCATCAGGAA
CACGCCGATCATAAACTTGAATGCATTGCCTCCGCCCTGATCATCGCCGGTTTCTTCTTCCCGAATGCTCTTCAACTCCTCAGAAACGTCAGGCTTGCGA
CGCAAAATCACTAAGCACGCTTCGCATGCCTCCCAGCCCTTTCGCTCCAAGAGCCAGAACGGACTTTCAGGGAAGATGTTCACAGCAGGAGTGATGATGG
CGATCATTATGGAAGCACCAAACGCTTGCCACACCCAGCCGAGCTCGTTCACGGACGAAAAGTACGCGTTCAGCAAGCTACCGAGCACAAAACCTGTACC
AAGCATGAGGATCGATTTACCCCGCATATCCTTGGTCGCGATCTCGAAGATGTAGATGGCAAGCGAAGGCAGAAGAATACCAATCGAGCAACCGAGGAGA
CCAATACCGGGCAGCAGCAGCGTTTTACGGAGGTCATCATCTGCGCAGACAGCTACCATACCAAGGGTACTGAAAAGACCACCCGTGACGATCGCCAAGC
GGCGCCCGATGAAGTAGGTCAAACAGCCCGACATGATCACTCCAAGCGTGCATGTACCGTAGACAATGTACGTCACTTTGCCATAATCACCGGTCAGAAT
TCCTTCGTAGGACGACACGTAACTCGAGAAACTAGCAGATTGCTCAAGTGTGGACAGCAAAGTAAACAGCCAGCCACAGCCGGCGCCGCCCAGGAGACCC
ATAAACGTGGCCAAGGAGAACGCATACTGGGACGACGCTGACATGACCTTCGAAAAACCTTCGTTGTACATCATACGAGTTTGAATAACGTTCAGGAACG
GAATGCCCGACATGACGAACAAGGGGATGATCATTGCCGTGCAGAACATAAAGTCGAACAAGAACGCCAGCTGCTGGAAGACAACGATGTTCGCGATCGA
CGAGTTGGCAAAACTCCACATTCGCATCGTTTCATTGATACCGTACAGTCCCGCGAAGTATCCGAAGAAAAGAGACATCGAGTACTTGAAGTCCTTGTCG
AAGACGATCCACATCGCCAAGAAGTATGCCACGATAACAGCGAGCAAAATGATCAAGTAGAGCGCAGCACGGATTATAGGGCGAACCGATCTCATACCCA
AACCAATCCCGTGAACGAATCCCAATAGTACAACGGTTGCCACTGCTGCACCAAAAGTGAAGGCAACGTACTTCACATCGGCTGTCTTCATCGTCGAGAC
ATAGAACATGAGAATGAAATGACGACTCTCACGAAGCAGCACCGTAACACGCGAAATCATGTTGGAGTTGTGATATTCTTGAAGGTCTCCTTTCCACCAG
GAAATCCATCCGCCTTTGTTCACCGGGTCGTCGTCTTTGTAGTCTGCATCAGCAAACATCCAGGTCGCCCACGCTTTGATATCGACTTTTGTTTTCTCCC
AATCCAAACCATCGGTATTGAACAAGAATGGCCCAACGATCCACAGAATACAGATGAACCAAATCGAGAAAGTCTGCACGCCGTAGCCTTGAGCAGTTTT
GCGAAATTCGAAGGCAAACATATCGTCTCCAATTGGCGCATCGGTCTGACCGATGAAGAAATTGCCGAAAATCAAATACACGAGGCACAGACCCACCAAT
TCAAATGCTTTTCGGTAATGCGTAGCTGAGTAGGATTTGTACAGCAGCACCAACGTTTCTCGTGTGATCTTGAAACCACGACCAGTCGCTTGATACTTGG
CACCTCCGTGCAGAACGTTGTTGTCGAAGTAGTGCATCGTAGTACCGACCTGGAAGACGAAGAATGCTGGGCCGAGAGTAATAATCATCGTGATGAATCG
CTCCATACCTCTAATGAAACCACCTTCGCCGAAGTAGACACACATCAACGGAAGCATGAGGAAATTACCGGCTTGGATGTAAAACTGAGTGTTCACCACA
GCCTTCAGATCGGTGAGTACTCGGTCGTCGAATCCATTGGCAACATTGTTCTTGATAAGATCCGTCGAGTTCATGCTGAAGATGATCTCCGATTGGACCC
CCGAGAGAGCCATGTACACTTTGCAGTACATGTACACAAAGGCCGTGACAATGGTCATCCACGTTGCGAAGTAAAAACCAGTGTGGGAGTAATACATCGA
GTTGAGGCGGAAGAAGTCCAAAAATTGGCCCATACGATGAGCTTCACGCGCAAGAGACGTCTCACCCGCACCATTTGCCAATTTGCCTTCAAACGTCGAG
ATCTGAGAAAGAGCCACATCACGACCCTTGCCGCACTGCATAAATTCCACGTGCGTAACAATACCACCACGCAGGGTCGCATTGAAACCAGCAAACACAT
CTTCAGACAAGTTGATACTCTTACTTGCTTTCGAGACACCGCCACGGCACAAAGCAATCACCTTGTCGAAAACATCGGGGTGACCATAGTGCATACGAAC
GCAGAGGGGGTCGGCGAGCACACGCTGCGACAAGGTCACGAAAACAAGCTCTTGCCACGACTTGAATTTGGAAAGGGACGAAGCATTACCGGTAAAAATG
TGCTCACGCATACCGATAATCGACACCGGTTTCTTCGATGGGTGCAGATCAGCCGTACGAAGGAAGTGGGGCATCTTAAGACACTCTTCAAAGTAGTGCT
CTTGGTTCATATCGATGGTCTTGAGGAACTCACCGCGACTGAACGGAAGCGCATTGTTCTGATTCTCTGGCTTGCCTTCACCAAGGATAGGATCACCTGG
TAATTCGTACCGATACACTTCCGCAATTTCGTTGTTCTCACTCTTGATCAGCACAGAGTCAAATCGCTTGCTGCCACCCTCGACGGCAATGGTATCGACA
TACGCTACTCGCAGATTCGGGTACGTCTTGAGAAGGTAATCGATATCGTCGGCTTGCACTTTGCCTTCCGCTCTGTGCTTACCATATACTTGACAGGCGC
AAATGTACGAAAACTTCAAACGCACCATATCTTCCAGTTGTGCTTGCTTTTGCTCTGCGGTCTTTCCAGGACTCGACCCAATTTCCAACCAGTGCAGAAT
TTTAATAGCGTCTTCATAAAGCATCATACCTTGAACAGTACGAGCAAGTGTCTGACCTCGATATGATGCCCACAAACGAATCTCCATCGGGTAATTCGTT
TGGGCCTCTTCAGCTGAGTTCACGTCCACTCGTTCCAGGAAATTCTCCCACTCTTCTGGATGGATGGTGATAAGATACTTCAAAATGGTAATGTTCTTGC
CATCTTCCTCGACCTTCTTGAAAATTGGGTGATTGGCAAGCGGATTGTTCAGTTCATCCAGCGCGTACAGCACACTTTCACTGTAAAACGGAGTCATAAC
GGAGAAAGAACGCATCTCCTTGATCGCTTGCAGCTGCGGAATTTCCATGACCAAAGACTTCATAAAGAAACCCAGACGACGTTGTGCTTCAGGGACTCGC
GGCATCGCATCGCTCTTTTCTAGGGACATCAACAAGTAGGCACGAGTAGCTGCGCCCATTGCTGTGTCGTTGTGGAAAAGGTTCACAAGTCCGCGAGAAG
CGTACACGTACCCATTCGCACTGGAGCAGAACTTCGAGTTCCCGAATTTAGCAGCGAGCTCAGGACGATTTGCAAAAATTCGGATCGCGTTCAGTAAGTT
CTCCATTTTCGTGACAAAGTTGCGGACAACGCCCATAGTGTGAACACGGGATGATCTCAAATGAGACGATTGCGAGTCAGGGTCAGGGAGATCCATTACA
GCTTCCAGAAATTCCATCGTGACGGAGCGCAGTTGAGTCAAACTCTTCGAGTCGAAGGTCTTCATGAAGTTGCCGCCAGCAGCAACATCCTCAATCGTAC
GAAGAGCATCCAAAACGTCGGCGTCGTCACTTCCGAGCAATGCCTCCATCACGTACATGCAAGCAGTGAAGAAGCTTCGAACAGCAGACAAGCAATCTTT
CTTCATCATGTAGGCTTTCAACTGCGAATCACCTTTTCCTTCTTTTGCCAATCGCACCGTGTATTCGATTGCCTCTGTCAATTTGCCAGCAGACAAGAAC
ACAGGTTCGAAAACTTCGCCGGAGCTCTGGATATCGTACTGCAAGATTGCTGCTTCCTTGTCGTCCACCAAATCGCTCTCGCGGAAAGAATTCACCACCT
CATTCCAAACAACCACGAAGCGAAGCATCATTTGAGACTGATAAGCAGCCGCAGAATTGTCGGCAGCGGCATCGTTGGAACGAGCAAGTGAAGTAACGAT
TTTCTGGTCAAAGAGTCGCGGAGCCACGCGAAATGCCTTGGTAATTTCCTTCACACCATGAATTTCTCCGGTTTTCATCCGTAAACCCTTGAAGTAACCA
AGAAGCGCCTGGAAAACCGTGAAATAAATCTGGGTGTCGTAGTTGAAGATGAAGATGACCGGCATCCACAAAGCCATGATGTACGCCAAGTTGTGAAAAG
AAATCACGTTACTGCTGTACGTCAGCTTCATTGTGTAAATTGCCAACGATGGCGTCATCAACGGTCGAACCAGAATGAAGTACGAGATGAATGCCTTCAG
TGACCATAGGATCAGCCAATACGTGATATACTTGACCTGGAAACTGAAAGGTGGAGCCATGTTTCGTCCGACGTAGCAAGATTCGCCTTCGCGGATGAAC
TTTGCCGCATACGTCTTGGTGACGATGTGAGGTACGAACGCTTGAGCGAGCAGCACGCACACACCAGGAGTTGCAAACGCTACCGCCGCGACCTGAGCAC
TATCCAAAAGTTCGGTATCTTGACCTGTATTCAGCGGCTCGTAGATCATCCACCCGAACAAGGCGGCAAAGGCACCGTTCCAGATTAAACGGACTGTCAG
CGCGCCGCCGTACGTCAACGACCGCGAGGAGGATGCAGAAGATTCACGAGCAATCAACAGATGCCAGCCGTGAGCTGCTTCAAGCAAGCATTTAAACATT
GCCATAGCCGAGTGCGAGAACACCAAAGAGATCAATGCCAACTTCAAATCTCGCTTGGTGAAAGGGGCGACAACTTCTCCAAGAGTCTCGAATTGGGCAA
ACCACATTTTACCACCGCTCGGAGAGATTGCGGACGCAAAACTGAGCACCAATAGGATGATGAAGAACATCATGTTGAACTGGAAAATACGGTAGTAGTT
CACCACCAGCGTGAAGATACTTCGATGCTCGTAGTACGTCTTGCCGTGGTTTGCTGTGAGCTCGTCACCGATTTTCGTGACGTCGATGGTCAAGCAGTGC
TTTTTCCAAAAGTACTCGTTGATGTCGTCGTAGTTGCGCACCTTGGTGTGCTCTAAATGCTTGCCGAGACTGTTCTTGCGTTGCATGTTGCTCGCTTCTT
TCCAGACAGGGCGCACGACTTGGCGAAGGTACCATCCTTCATTCACTTTGTCTTCTCCGAGTGGGTCCTTGTTCAGCATAATCAGCATCTGGTGGTACAG
GTAGCATAGGCACTCTGGCATGTGACGCAGGTTGCCTGCTTCGCCCCAAATCAGCAAGTACAGTAGAATCTCCATGTGTTTCACATTCTTCAGGTTGCCT
TGGACCGGTCCCTTGTACGATTCCGCGCTCACGCCAATAAACTGCACCCACTCGAGGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGGGTCGGACGGTTTCGATCGCGCCTTGCCGTTCGCGAGCAGCAGCAGCACGTGCTCGCGCTGGTTGTCGACCGATCCGGACTGGAAC
CCAAACTTGTTGTACAGCACTTCGCAGCAGTAGTCGATCGACACTTCGTCGTCAAAGTCGCCCTGGAGCCCGCCGCCGAGCTTGGCGTTCGGCTGCTNNN
NNNNNNNNNCGTCCATCATCGAGAGCCGCGTCGAGAACGTCTCGCGCGCATCGTGGCCGTTCTGGAACCGCGTCGAGTTGTTGCGCTTACGGTCGGCATC
GAGCT