Description :
From Genome Similarity Track
Location :
Scaffold_240:27074- 30367
Transcript NameFunction/comments
Phymu_g7369conserved hypothetical protein
Phymu_g7370hypothetical protein PHYSODRAFT_490699

Sequence
3293 bases(100 bases per row)
GCTCAACGCCAAGCTCTCGCTCTGGCGAGGCCCACTGTATCATCTGCGTGTCGACGCTGTGGTTAACTCGACATGCGAATCCATGCGCGAGAGTGACGGC
GACTTCGGCAAGCTATTAAAAGCCGCTGGGCCGGAGATTGGGGTGGAGTGCGATGCCGCAGGTTCATGTCGCACAGGGGACGCCGTGCTCACAAGGGGCT
GCCAATTGCCGGCCAAATTCATCCTGCACACGGTGGGGCCCCGCTATCTTCCTAAGTACCACAACGCAGCAGAGCACGCACTGCACTCGTGTTATCGCAG
TGTGTTGGCAGTCGCCAGGGAAAACGGACTGCGCTCGGTAGCTATTGGATGCATCTACACCCAGCGTAAGGGGTATCCAAGAGAGGAGGCCGCCCACGTT
GCGGCGAGAACCGTGCGGCGCTATCTGGAACACTACAGCGGCCACTTTGATCGGGTCATTCTCTGTGTTGACTCAGTCCAAGAtttgtacgtgtacgaga
GAGTTCTCCCGCTTTACTTCCCGCggacgatggaggagctacagcagtcgcagcagttGCTTGCGACGCGAAACCTCGGTTTGTCTTTCTCTTTTGTGAT
TTTGGCATCGCAAGGAGCGACTTCAGTCAGTACTAATCGTTCGTTATTTCTACCAGGCAATAGCTTCGGTGAGCCCATTATCGCAGAGCGCAAGATTCGA
ATTGGCAACCTCAGCAACTCGGGTCATCGCAGCAACCAGTACGAGTTTGATCCCAACGATAACACTGGCGGCCAGCAGGACAGTTGTGCGTTGTCCGACG
AGGCCACTGCTGACCCAGGAGCAGACGAAACGGAGAGCGATGTCCTGGCCTTTCGTGCCATGCTGGTCGATCCTGATGCCGGACGCTTAGGCTGGCTGCA
ACAGATGCAGGAAGAACGACAGcggcgagctgcagaagctgcaatTGAAGAGCAAAAACGACTCGAGAAGGTTACAGCTAGCACAGCTGAATGGGACtac
gtcgctgctcttcgacgcGCGAAGAAAGAGGATTTTTCAGACCTGAAAGCTCTCGGGTTTTGTTATTGTGGCGGGGTTGATCTTGCGGGGCTGCCAGTTG
TGGTCTACCTCGCAGGAAAGTTGCgcgtggaagagctggataTGGAGCGTGTACTGCTCTTCGTACTATTCACACTTGACTCGCAGCGTGCAGCTCTGGT
TGCGACCTGCTCACAATTTAGCCTGCTGTACGTGCACTCGGACGTCGCAAACGACAATCAGCCGCCCAATGCTTGGCTCAAACGCCTTTTCCGCGTGTTC
ACTGCGGTGGCAGCACACCGCGCTCCAAGCGATCAACCCCTTCAGAACAAAACGGGCGACTCAGTGCTTCGCTTTTTCTACGTGCTGGAGCCATCGCTCG
GATTCAAATTCCAGTTGCTGATGTCAAAGGGATACTgcgacggcggtggcttcTACAATCACGTCGTGTATCTCCAACGTTCCGAGATGTTAAATAGCat
cgctccagctcttcagcttcctcctcacATCTACTCGTACGTGTGAGCACGAACCTTTCAGTTAGTTGGTGTTTAATCGGTGATGGCTAACGACAGTGTT
TTCGGCTTCAGTAACTCCACTCCAGAAATTGGTTCGCCATAACTTGCATCATTTGCCTTTGGCTTTTGATTATCGATGTCTACTGGTTCCACTTCGACAC
TTGCTGCACGATTACCAAGGACTGTGCATCTGAGCCCGCAACGAGCGTGTCGGATTCCGCATGAACCGCCAGGGCATTCCACGGCTGAGGTCCAGCGTAC
AGCCGCTGCACCTGAAGGCCCTTCGGGGAGCCGTTGGTGGCACCCAACGAGGCGAAAGGAGTCAAGTTCTGGCTAACTGCAGGTCCGCTGTAGCGCTCGT
ATTCCACCGCGTCGCGGGGATTGCGGCCGTGGTGGAAGTCCCAGCAGTTCACTACGGAGTCGTCACCACCCGTGTACAGATACCGAGGAGATGCTGAGTG
GAGCTTCAATGCGCGAATAGCACGTTGGTGATGTGCTTCAGTACGGAGTGGCTCTTCGAGTTTGCGACGATCCCAGAAGCTCACGCGACCGTCATCGGCA
CCTGTGATCAGCAGTTCAGGGCGAGTTGGATGCGTCTCTAGCGTAGTCAAAATGCCCTTCGAGCTAGGACTGTGATGAAACCATTGCAAGCAGCACATCA
GTGCTTATCACCACACATTCAAACGCGATACAGTAACGTACTCTGCGCATGACGTGACTGGGAACTGGTTGTTCGCGGTGATGTCCCAAATGCGAAGCTG
ACTTCCAGGAGTTGAGCTACCACATCAAAAGAACGCATCAGTTCACCACTGACCCACGCACACTAATACTAAGAGCTGAAGCGTACCCGACAGTGGCAAC
GACAGAATCCTGTCCCAAGAACTTCACTGCGTTGATCGGCAGTCGGCTCGTGTCCTTGTTCTCTGTAAACAGCCCCGACATCCACGCAACGTGAGCCCTT
GTCTCGCAGCTCTCCATTTTTATCAGTGCATTCCCTACCAAGGATTTCAACGCCCACAACATCATCCAACTTGAGCCACGccagagctccaccagcgctG
GCAGTCACGAGAGTCGTGCGGTTCTCGCTCACTTCCACACTCGTGGCTGAAGTGCCAGCAAACACGTTCTCCCACTGTGGCACAGCAAATGCAGACAGTG
GTTTGCTCGAGTCTCCGTCCGACATAGCTGcatcgtcatctccagcactggAAGACACGCGGTACGCGAAGACGCCGCCCGCGGACGACGCACTGACCAG
CAGGTTCTCATCTCTGGAGGCAACAAATTGCAGCGCATTCACGTCTCCCTCATGCTCCGCCTCAGCCAACGTGTTGAGCTCACACGGACGCGAATCGCCC
TCACCACGTCTAGCAATTTTTAAGGGAACAGTCAGTGCAGCTCCAATTATCTCCAAACCAGCTACTGGCGCACCCGAACTCCTTGTGCAGCTCCCGCTCG
TCACGTGTGCGACGCGCCGGCAAATGCAGTGCTATGTGGTTGGTCTGAGCAGAGTCGTAAAGGTGGTTATTGGGTGAATTTGGCGAATAGTTCCGTGAAC
AGCGCCAGTAACTCACCTCGTTATCCCATCCACCGGTCGCCACCAGAGGGAGAACGTCGTACTCCTCCTGCAGTGTCTCGGAGGCGTAGCGGACGTCGCT
TACAACGCACACAGCCTTGACCTTCTCGGCCAAGAAGTGTCTCGATACGGACGCCATCCTTCGAGCTGTTGAGTGGGTGAAAAAAATAAGTAC