Description :
From Genome Similarity Track
Location :
Scaffold_170:27071- 31861
Transcript NameFunction/comments
Phymu_g5982conserved hypothetical protein
Phymu_g5983hypothetical protein PHYSODRAFT_295452

Sequence
4790 bases(100 bases per row)
ACTCGAAACCCACATTTTGTCCATATTATCGTTATTagtgcagctcgtgctgaaTGGAAGCGTACGTGGCTATATACGGGTAAAACATGCATTTCGGTGT
GAAAGCGAGTTGGCTGCGCGCTTAGAGTCCAAGTGGCTCCGCctcgacttcctcctcgctcttgaCTTCACCCTTGGTCGGCAGTTGCTGTGGCTCGTGG
TCATCGCACTGCGTGACCCACTTACTCTTGACCGGCATGATGTGGCAGTTAATGCGCATGACCTTGAGTCCCTTCGTGACTTCCAGGTCCACTTGGGTCC
AGTTGTTGCGTTGGTCTGGCATCGTGCAAATGTGACCCACCTTGGGCTGTCCGCAGCGGCCACACTTGTACAGCTTCCGGTTCGCATCGTCAAGGTTaat
cttcttgttgcctgATGAGGAGGCAGAGGGATTCACGCTGCGTCGCGGTGGCGACCGGTGTGGGTTAAGGTCGGCCATGCTCGGCTCCTCTGGAACTGAG
AGGAAGCCCAGGTTCATCTGGGACATATCCATCGAAAGCCCTGACGACCGGTTTGTACCGCGTCTGCGAGCAGCTGCGCGTGGCGGCAAGTTACTGCCCA
GAGACGACCGACGGCCATGCAACGAGTGAACGGCGCCACTAGCAATCTGAGGCGGTAcctggaactggaactgctgcatATTCGGCTGCGGTGGCGCAGG
GAAATTCGTCGGGTCTTGGAAACTAGCGAATGGGTTCGCGAATCCTTGGTTGTTCGGATTCATGTtttgttggtgctgctgttgcgcttgttgctgcatc
tGTTGGTGTACCTGCACCGGCACCTGCTGAGGCTCCTTGTTTTGCTGGGCCAAGACGCGGAACTGATCCAGGTTGTACAGTAGGTCCACTGGATTCGAGT
GATGCCTAGAGTGGTGGTTCACTGGGCGCTTTCGCTTCATTTTGAGCTCATTCACGCCTTCCTGGATGCGCTGGGTGCGGTAGGCCACGGGCGAAGCTCC
AGTAGTAGGCCCAGCAATTCCatccgtcgtcgctgcatTCACCATAGgaacctgttgctgttgctgttgctggtcgGGATTGAGTTCCGACCACGACAGC
TCCTTAAGGAACTCATCCATCTCCTGGAACGACTCCCCCTGAGGCGTCGCGGTGCCTCCGAACTGCAGCGCATTAACAGGAGGATCCACCTGAACGGGAC
CTATCGGCATCACATTGTGCTGAGGAGGGAATCCCATGCCGTTGGACCCCATCACGGGCGTCGTGATGACACTGGGCGCCATGTTGGCCATGCCGAAGCC
CTGCAGCACATCCGGATTGGAGCGAActcgcttgtgcttgtgTTGTGGAGCCACGCGGTAGTTAGGTGCTCCGGGAGCTGCCCCGTTCGGGTtaaaggag
aaggagagcggCGTGAGCAGATCTTCACCCTCAGACTTTGGCGCCATCATGTTGGTGGGCGATGAGCCGGGAACGTCACtatccagcagcatttggtCGT
CGGGTACCACGAAACCGGCAGAGGAGGAATTGGGGGCGTTGCCATTGCTACCGGTCATGGAGCCGTCAGCGGACGGCTCGCCGCTGCCTTCGAGGAAGTT
GTAGTCGAGCGGTAGGCCGTCGAACAGGTCCAGTGTCTGCGCGTCTGCCATGGAGAGCGGTATGGGGAATGCTATAGGGGCGAGGGCTCGGCTTCTCTTC
TGGTTCATTGCTCTTGATTCGACAAGAGCCTTTAAATTATAATGTATTCCGGATAGGTGGTTGCACAATCTTGAAAAGAATATTATTACACCTGTATAAC
GTTATAGGTCCGGATACGTAACTGCATGTACTTGCGACAAGTAGCCTCGGATTGGCCAAAATACTGCACACACCTAACTGTGATCTACCAGCTGTTAAGT
GAaatatggctacatgtacagtcgACCGGCAACTAGTGACACGAGCCAAACGCCAAAGATAATTTTTAAGTTTAATTAAAAATGAAGCTGTAACGCGTGC
TGTAGATAGAGCCCGCAAACGACACTTTCTTTATACTTCCTTTATACATACCTATGCGGTGAGAGTCTCACTCGATACAGCAAGCCCTAGAGCGCCTGAG
TGTGCGGAAACGCCATTGTTGGTGTGCCGCCGAAGCTCGAGGTGCCCATCTCGTACGTCACGGTCTCCGccggctgctgctccaccgTCTGATAAAAGCT
TGGGTCCAATGCgccagctcgtgcaggaTCTTGCAACAACGCCTGCAGAATGCACGCGATTGGCCGTCAGCAACCAATTTCAAGCTCAAGGTGTCCGTCC
TCACAGAACGAAGCCGGGCCGCGCCAGCGAAGTATGTGGCGACACTGTACGCCTTCCAGTCTCGCTTCCTCCCAGGCAACAGACACTCAACGAGGCACAG
CGGACGGCCTTCTTAGAAAAGAAATTCACTCACCTGCAGACTCAGTGGACTCAGCTGCGACGCATCCTGGCGTGGATACGGATCCCACATACCTGCACCG
TTGGCACCGggctgctgaggctgctgggtttgctgctgctgctgctgctgctggctaTCGGCTATTCGGTGAATGCCGTCTTGGTCGATCTCGCCGTTCG
CGGGCGGAACAACAGGTTGAAGCCAGGTCTCATTGccattctgctgctgctcgttctgGTGTGCTGGAGACGCGCCTTGGCTGGCACCGCCATTGGACGT
CTGCCGCTCGTAGTACCGCGGGTCGTAACCACTGTAGTCCTGACCTTCATACTGCTGCGGTGTGGCGTAAGACTGCTGGGCAtaggcagcagcagcgtac
aAATTCGGATCGCCACCCGGTGACTGGCCCATGAGCATAGCACGGTTTTGCTGATACGGCTCGGCCTTCAAGTCCTCTGTAAGCATGGCAACGTGGCTAA
TGTGCTGACCCTgttgcatctgctgctgcatcatttTCTCGTGAAGACGCAtttgctgcaactgctgctgctgatcgagctgctgcaccgctTCGGCATT
ATGCGCCTGgagatgttgctgctgctgcagaagttgCAACTGTCGCTGTCGCATAAGCGCCGGGTTATTGTAGCCCATTGCTGCCTGTTGTGCTGCGGCC
GCCtgagcttgctgctggttcttcttgtgctgAGCGTGTGACGCCGCGGCCTTGCTCGGgttctgcttcaacgacTTCCAGCGGATCTTCACTGAGTCCT
CAGTACGTCCCTTGAGGAGCTGTGCAATCTGTGACCACTTGTTGCCAAGCCGTGCTTGAGCGGTGAGGATCACggagtcttcctcttcagtgTAGGGGCC
CTTATTGATAGCCGGATCCAGGTGGTTTTTCCAGCGTTCTCGGCACTGCTTGGGGGTACGCCCCGGAATACGCTCAGCGATCTGGCCCCAGTTATTGCAC
CCCTGCGTCACAAGATACTCCAGCACCTGATCCTCTTCAAACGACCAGTGGCCCTTAACAAGGCCAGGCTTGAGTACCTTGCGCCAACGCTGCAGGCACT
GCGCATGATTCCGACCAGGAACCAGTTCAGCAATTGCCTTCCAGTTCTTTTCGCCATGAATACGAACGCTCTCCCGAAGTGCCGCATCCTGGCTCTTGGT
CCAGCGCTTGGTCGTCGGAGCCTCGGGGTCTTCCGCAGGTTCAATGTTTCCGTTGGAGTTCTCAGTATTTTCGTTATTGGCAGCCATAGGTGTCCCTGCA
TCGGAGCGCGTACGTTGAGCAGGCTTCTGCTCCCTTTCCACCAGTGTGCGGCTGCTCTGCGGGCGGTCGCGCTTGGCAGCTGagtcatcgtcatcttctg
tGTTGGCCGTGGCGGTGTTATCTCCTGGAATAAACCCCTTCTTGTTGATTTCCAGCTCGCGCAGGTTCAATTCTGAATCGGCGATATGTGAGTTGCTCAA
AAGCCGCCCAACTTGTGAGATATCTTCCTTAGAGATCAccacagacgacgacgatagGGAGCGTCCAACGACCGTGCCATCAGCATTCGGCATACCAGCC
AAGTGCTGCGCTGTAAGCTTGTGACTATTAGTTTCTTTGCTGGAAATAAATATAAAATAGAAGAAAGAAGCTTTAGCACAACAATTGAAAAAAATGTACG
AGATGAACGTACCCATCGGGGCCCACGACGGCATTAAACGAGTGGAATTTGTTGGCTCCACCGTTAAGCATCTTGACACGActggctgctgaagccaaAA
TAAATAATGAAGCCAGCGTCAGGcgtgaaaaaaaaaagaaaaaaaagcaatGAGAGCAAAACTGTCAGCATACGCACCGTTAAGCGCTTGCTTACGCTTG
AGGTGAGACTCCAtgttctgctcttcttgagcCTGCACCTCAGCCAACTTGGCCTGTTGGACGATGAACTTCTTGCGCAAGTTCAGGAtaaacttcttct
tgccttccACAGTGGACTCGGCCATAGCTTTTATCACGCggaactgcttctcgtcACGCAGGCGGTCAACGTAGCGACAGAGCTCGGCACTTTCACTTGG
CGAAAGTCCGCTGAGCGCCATGAGGAACAGCCGCGACGCCTCAGCGggcagcgactgcagcaattgaGCCAATAGGTCGCCGAAGTTGTCGGCGCTCGCT
GAGTCCGTGGGCGGAGCTGGCTCCGGCTGGTTGTCGGTGGCGGTGTCCGCCATGTTGTTGCTTCTAGGTCTGGATACAAACAAGTGAGAGCTTTGCCGCT
TTTAGCTGCACGAGTGCGCACTTGGACGAATATTGACTTTTGCCGGCCAGCGGTCGTTCTCCCCCTTTTCGCTACGGTCTCCCCTTACCC