Description :
From Genome Similarity Track
Location :
contig_67:270673- 271676
Transcript NameFunction/comments
g11619.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
CGTCCACACCACGGCGCCGCTCGGATTGAAGAGTGCGGCGCCGGTCCCGCCTGGGCCGGGGTTGCGTCTGCAGGCGCCGTCGAAGCGCAGCACCCACGGT
TCGAGTCCGGCCGACCCGCCGTCGACAGCCATTGTCGCTGCAGTCGTGGCAGCAGGAACGTGGTCGCTGACCCCCGAAGCGCCAGCAGGAAGTTGGCCCG
TGGCCCCTGCGGCGCGGTCGGGAAGTTGGTCAGCGGCCCTCGAAGGGCCCCCACATGCGCGAGGCCGTCGTCCAGGAGGTGGGGGGTCACTGTCACTCGC
GGCCCCCAGCGGGTGCTCGTCCGGCCAGGCGGCAGCATCGATGAAGGCTCTGCGGCGCTGGCGCTCTCCGCGCTGCGTGCTGCAAGTCGTGGTCCCCACC
GCGTGGCGCGACGGCCCAGCGCAGTGGGCGGCAGGGTTCGTCGCCGTGGCGGAGCCGGCACGGTTTCCTCGCCGGTCACCAGCCTGGCGATGGCCGCCGC
GCCCACGGCTTGGTGGCGCGGTCCCCATCGAGTCGTCCTTGGTGTCGTCGGCGCGGGCGGGGTCGGGCAGGCGTTTGTTGCCAGCGGCTCCATGGCATCT
GTGAGCTCGTCCAGCAGCTCGTCCTCGGCCTCCTGCATCAGCTCGTCCAGGTCGACAGCCAGCTCCACATCGTCATGGTTGTTGAGGCGGCGGCGCTTGC
CGCCAATGCGGAGTTCCGGTGGTGGCTGGAGTGGGCACCCCGGGGGGGACGTGAGGGTGCCCGGAAGCGGTTGGCACGGCGCTCTGTGTGTGGGCGGCAC
CTGCAGCAGCAGTGCCGCTTGATGTGGCTGCTACAGCTGCAGGCACCGCCGCGCGGAGGGGCCCGGTAGGTGCTGGGGCCACCTCGGTGCGCTGGGCGGA
AAGCGCTGGGGTCGCCGGTTCCTGCATCGCTCTGTCTCGCGCAGCCGCTTCGTTGACGTGGGCGCTTTGGCCACACGCGAGAGCATGTTTCGTCGCCGCT
GCG