Description :
From Genome Similarity Track
Location :
Scaffold_2:2706582- 2710856
Transcript NameFunction/comments
Phyin_T30-4PITG_01535Myosin-like protein

Sequence
4274 bases(100 bases per row)
TTTCATCTACTTACAGCCCGCCTGTCGACTTCTGCCGCGCCAGCTTCTGTGCCTTGAGAGAAGCCAGAGTGGGGCGCTCAAACTGAGACTTGCCGAGCTT
GCGGTTCACGTAGTACACACGACCCGTCGAGCGCGACACCTTCGCCTCCCAGCCGACGGGAAGAGAGACTTCCGGCAACGCGTCCAGGTTGAACGACTCG
CGCACAGGACGATCCGCCGGCGTTGTGGCCGGCTTCACCTTGGCGCTCTTCGAGGTAACGACCGTCGTGGACGCAACGTTGTCGGACGGGTTGGTGTTCT
CCTCTGGTTTGCTGTTTGTGCGCTTGCTCCGGTTGTCGTACATCCCCTTGACGACCGACATGCGGCCCTTCAAACTCGACATGGCACCAGTCACGCCCAC
TTCCATGCTCTTGACAATCGTGTTGCGCGTGGAAGAACTGTTGGTGGGGCTGTCCTCACCTTCAACCTCCGAGACGTCGAAGCCGTCCCCACTGTCTCCC
TTTTTGTTCGTGTTCCAGAAGCGAGAGCCTACACTCATGCTGGGCATGCGCGGGAAGTGGCGCTCGGACGGACGCGTCTCTGATGATGGGCGGTTAAGGT
CGTCCGAGCCGGTGAGCGAGTCCATCAGTACAGTCTCACGAGGTTTCTTCTCTTTCTTGGAGCCCAGCGTGCGGAAGATCGACTTCTTCGGCGTGGGTTT
CTTCTCGGGAACAACACCTTCAGCGTGAAGCTTGGCGATCTGCTCCGTCAGCTTCTTGTTTTCGGCCTCGAGCTGCGAAATCTTCTTGTCCTTGTCACGC
ACAGTATCTTGCAGTTGGCGAACCTTGACGTGGTTGCCAGCTGAAGAGAACTCCTTGTCGCTCTTGAACTTCTCGATCTCGGCCTTCAAGCCCTTCATAG
TAACCTTCATGTCCTCATTCTTCTCACGCAGCTTCTTGTTCTCGTCTGTAAGAGTCTCGATCATACCGCCAGCATCAGCCATCACAACACTCGAAGCAGC
AGAGGAGTCCGCCGTCGCGACGCTGCTGCGACGCTGCAGCTGAGCATTCCGCTCCTGTTCTTCCTGCAGAGCAGCCTTCAGCTTGTTCAGCTGGTACGCC
ATGTCCGCCTCACGACGCTTCTCCTCGAGAGCAGCTAGATATTTCGGCCGCTGAATCGTCATACGAACCATAGCCTGCACACGAATGACCATTTCGCGCA
TCTTGACATAACGGTGACGCTTGACAAATCCACGCATATACCGCTGAATGATGACAGCGTTGTGGTTACTCTTGACTTCCGCAGCTACCTTGCGGCCCTG
CATGCCTCGCCAGTGAGCCTGCGCTGAAATGAGGCCCTTCATGAACGTGTTGTATCTGCGCATAGCGATTACACACCGAATAACCGACTGCAACTTGATG
ATTGCTTCTAGCTGTCTGAGGTACTTGATACGCTGCGTAAAGCCAACCATGATGTTCTGTACGTACGTGGCCTTGGCATCCAGGAACTTCTTACGGCGGT
CCTCAAGCTCTTCGAGCACACCTAGCTGGAAGTACACACGAGTCTTACCCATCTGATACTGAGTTGGGGATTCCAGCTTGAGCTTGTCCATGAGCAGCTG
GCACTTGTCTGCAGCAGTCTCGCCACCACTCGGCACGAACAGCCAGAACTTGTCCAGGATCTCCGTGTGCTGCAGCCGGTTCGGGTACGCTGCACGGGAG
ATACGAATGGCTTCAATCACACCGGCACATCGCAACTGGGACACCACCATGTTTTGGTCCATGGCAGTAGCGCTCTTGATCGGGTTGGGCTTGATGCAGC
GTACGTAATGTACACGCGTCGAGTTGATGGTTGCCATCAGCTCCGTCAGACTCTCTTTGAATTGGGTACCCACGGTCGTGATGGACAGAGCACCGCCACG
CTTACGGCGGCTACCTGACGCCTCAGAAACAGCTGACTTAGGCTCCGGCTTCGGGTCGAAGAGCTTGGCGATGAACGGCTTGGATGAGCCACGCATGAGC
TCGGACAAGTCAGGCAGCAGTGAGTCCTTGTGCTTCTCCAGGAATCCCACCGAGTCGTACATGACAGGAGCGGCATAGTGCTTGATGAGGAACTCGGTAC
GAGACGTGCGAGGGAACTCAATAACGTGCGCCATATCATCCTTGTGCAAAGACGTCACCTTGGACATGAAGGACTCCTCACTGCCCTTCGGTCGCATCAC
CTCTTCGTTCAGCAGCGAAATGATACCCATGCGCGATTCAATCACAGTCAGCACGTCCTGGTTATCCGCGTACTCAATGTGGTCCCACACGATTCCTTCC
TCCTCATACTCAATCTGCACCGTCTTAAACACATCCTGTGTGAATTTCTGCTGAAGCTTCTCGTTAGCGAAGTTAATGCAGAACTGCTCAAACGAGTTGT
GCTTGAAATGCTCGAACCCGAAGATATCGAGCACACCCACGTGGTTGGCCATGTTGGCATCATCAGCAAGCGACTGGTTGATCGTAGCCACAAGCCAGTC
GAACACGTTGGAGTAGATCGCTTTAGCGAGGGCGTCACGACAGTCCATCGCCAGCTCTTTTTTTAAAGGTACACTGTACACATCATTCACAGCACGCATA
GTACGCGAACAAAGAGCCTTCTGAAGTGCCTCCCACGTGACACCAAGCATCTGAGTAGCACAATTCGCACCACCGTCGCCCTCAGCGATGAGAGACTTCT
CATCATCTGCCGGGTCTGACTGCAGCTGTACCTCACCAAGGTGGAGCACTCCAGCCAGCACTTCGAACAGTGGCCGCTGGTCATCGCGAGACAGACCCAC
AAGCTCCAAGGCCTCGCGTGTTTGGTTGAAGTGTTTCTTGTCGGAGAGTCCTTCGATCTTCCGTGCCGTGTTGTCGCCCGTGTACACATAGTGCTTCGAC
GATTCGAGCTGCAACTCCGACGCAATGTCGGGCGAGTCAAGCAGTTGGTAGAAGATATGGTAGTTGCGTTCAGGCGCTTCGTGCTGGATGACACGCGTCT
TTTCCAGAAGATACGTGCGGCACTTGGCACCGACAAGCGTGCCATTCTTGTCAAACTGCAGCTGTGTAAACTTGCCGAAACGACTGGAGTTGTCATTACG
CACAGTTTTGGCGTTACCAAAGGACTCGAGCAGCGGGTTTACTTCGATAATCCTCTTGATGGTGGAGTTGTTGAGACCGCCTGCGATGGTGGCCAGGTGG
TTCATGAGGATTTTGGTGGTCTCGGTCTTACCAGCACCGGACTCGCCACTGACCAGAATGGACTGGTTGCGCTCCGAGCGCCGCATGTTGTCGTAGGCAG
CGACGGATGTGGCGTACACGTGCGGGGGCAGCTCCTCTTTGGGCTGGTTAAGGTAGCGGAGGTGCTGGTCTTCAGCGTAGAGGTCTGGGAGCCACTTGTA
GGGGTTAATAGCGATGCAAATGTCGCCTGTGTACGTGTAGGGCAGCTCGCACAGGAAGCGCTTCTTGATGTTGAACAGGATGGCGGCCTCGTGCAAATAG
TTGAGCGTGATCATGTCCTCAATGCCCTCGAGACCAACGTTCTCGTTCTGGTACGGAAGCGACTCGAGTTGATGCACATCCAGTAGCGCCTTTGTCTTCT
TCGACAGCATGTCCACGCAGCGTTCCTCAGTCTCGCCATCGGGAAGTTCCACTTTGCAGTAGATCTTACGTGTCTTGCCATCGCCCGAGTTCTCATCACG
CAGTACTTCAGCCGCAAGCCACACGTGCGTCTCATCCGGCACGAAGCACTTGGCGCCCGCCACCATCTGCAGGTCGCTCATGGTGTTTTCAAATCCCCTC
GGCCCCTCTAAGAACTCAGGAAGCTGGCGTGGCAGACGGTCTAAAGCGGAATGGGTCGACTTGAGCCGAACGGGGAGCTGGCAAGATACCGCACAGTACC
GGTAGGTGGAGCCATCTTGCAAGTGGCAACTCCATTTACTTAAGGTTTGTAAACAATCTTTGATCCGACAACAATCTGTGACGACATAGCCCGGCCAGTG
CAGCTGGAAAGTCAACCGGCTGGGGGGATTTGATCGTCGGTGTTACCGACGGTGTGCGACGCAGTACAGCCTGTAGCCATGACCGTGTGCCTCCTTAAGA
AGGCTGCCCGCCTCCTAAGGAGTACTTAGGCGGTGCTATTGCAGTGTGCGCCTTCATGTGCGGGGTTTCTTACCTAAAAGCTTCTCCACAAGGTTACAAA
ATGAAGCACCAGATCTCATTTGTTTGATGGTCGTTTTCTGCAAGGAACATGATTTACCGTCCAAGCACCGGTTT