Description :
From Genome Similarity Track
Location :
Scaffold_67:27061- 29200
Transcript NameFunction/comments
Hyaar_Emoy2807653hypothetical protein
Hyaar_Emoy2807654hypothetical protein

Sequence
2139 bases(100 bases per row)
TCGCCCGAGGAAGAGACCTCGTGGTGATGGTACGGGCGGAGACGAACAACATAAAACGTAGGATGAATACGCATCCTGCGAGGCAACTCGATTGTGTACA
CATTGCCTTTGCAACGTAGTACAGAGAACGGGCTGATGTACTTGGGTAGTAGTTTACTACTACCCATATTAGTTACTACGTGCTTAGGTAGATTTACCAT
AGACAGTAGAACTAAGTCTTCGACATTAAATAGAAGAACGTTTGATCTTCCATGTTTGTCAGCGTTCCATTTGTGGCGGTCCACCGCGTTAGCGATGAAG
TCTTGCACGAAACGGACCACTGCTTTTCGTGCCAGCAAGAAATCTTCTGCTGCATCACTTTGGTTTGTTGCAGTGCGCTTTGTGCGCACCGCTAGGAGTT
CATCCTCTTTTTCAGCGAGGGTGTTCTCATCCTCGCTGGTGTAGTCATTGGCGATGCTGAATATACCAGCATCGTCATCCTCATCTGGGTCAGCAATAGT
GTCATCACTATTGCTAAGGTTATCTTCTTCGACGTTGACTTGATCGATATCGGCAACGTTCGTGTCGTCGATTACCTCGACACGTGATGAGAAAGAGCCA
GAACAGTTTTTGCTCAAGCGAATCCCTCCCCCCTTGAATTAGTGTCACACTCTAAATGGGTGAGTAGGCGTGGTTGGCGTAAGCCGTTCACGAAAAACAG
TGTATGTGTTGTCAATGCATGCAAGGCGTTGTTGATTACAAACTCCACCATCGGCAAAAATTTGCTCCAATCTGCGAAGGATTGGACGTATCCTCGAAGT
ATCTCTTCGAGGACGCGGTTGACGCGTTCTGTCTGACCATCAGTCTTGGGATGGTCAGAAGTAGACGTAGTCAGACGTGTTCCGATCCCTCGGAACACGG
ATTGTCAAAACGCCGCCGTGAACCGAGGATCTCTATCAGAGACTAGTTCACGGGGTAGACCGTGGAGTCGGAATACCTTTTCAATGAAGATACGGGCACA
ACCATGTGCCGAGATTGACTCATTAACTACAGCAAGATGTACCATCTTGCTGAATCGGTCTACGAACACGAGAATACCATTATTCTTGTCAGCGTCTTCG
GGGAAACCGAAGACGAAGTCCATTGAGACGGACTGCCATCACTCTGCCGGGATTGGTACAGGCTGTACTAGCGCGCGGGATGAAGAACTGGGCTTCACCC
GTTGGCACACTTCACAAGCACGAAAATACTTGTGCACGAACTGATACTGGCGGGGCCAGTAAAAATCGCGACTTACCGTGAGATAAGTCTTCTCACGCTC
ACGATGCCCACTAGGTGGTGCATCATGGCACTCATACACGATGCGCAAGCGCCAATCATTATTAGTGGGGACGACGACACGAGGTGTGTAGCCGGCAACG
ACTGTATAATACAGCAACCCTTTGCGTGTTGTGTAGCGATCCGCGGAAGATCGATACAAGGCCGGTTAATCCTTGAGAGATTTACGAGATGGAGTCACCA
GATAATCCACTCCACTAGTCGCAGAAGAGCCTTGTCTTCTGAGTAGGCCTTTTTATGTCGTCAAGCAATGTTGACGACGGAACACTAGTGACTAGTGTTG
CAACAGTGGTATCAACCTCACTGTTGGACTGCGCAGCCGACTCGAAATCGGGTAGGCGCGACAACGCGTCCGCGATGACATTAAGTCTTCCGGGTTTGTA
CTCCACGGAGAAGTTGCACCCTGCAAAGAAGGATAGCCACCTCGCCATCATTTGCGAGAGGTGTGGGATGTTTACGGCCGTGCGTAATGACTACAAACGA
CCTATCTCCAAGGATATAGACGCTAAACTTTGCCAGCGCATACGTTATGGCAAGGAGCTCCTTTTCATGCACTGAATAATTACGCTCAGCTGCTTGCAGC
TGACGCGATTGATAACAGACGACGCGCTCTGCGCCGTCTGCATAGTACTGCATTAACGCGCAGCAGATTGCGAAATCGCTGGCGTCACAGACCACGTAGA
ATGGTCTGTCTTGGTCTACAATCGCCAAGATGGGCGATTGCATCAAGCTCTGCTTGATACCTTCAAAGGAACGCTGACAACCAGCGTCCCATGAACATTT
CTCGTTCTTTTCAAACAGTAGGGTTAGTAAACTAATTTT