Description :
From Genome Similarity Track
Location :
scaffold_402:27060- 29329
Transcript NameFunction/comments
g8039.t1hypothetical protein

Sequence
2269 bases(100 bases per row)
ATGCTTAAGTAAATGTATTTGTTAGTCACAGAGCAGACTTCTCTTCTTCATCGCCATATGGTTCCCTAGAAGTGCTGGTGCTCGATACAAACTCGGCAAG
AATGTCAGAATTGAAGTCATCCATGTACAGATCTGGGCCGATGTCAAACAGAAGGTTTAAAGTCTTGTACATGCGGTACTGGCCTTGAGGAATTTCTTGA
CATTGTAGCAAATTGACGAGCTCGGGGTTCCGGTTTAAAAAGATGCACATGTCGATGCTTTCACCCGCCAAACTTGTCCGTTGCGCTGAAACCATTTCGC
CGCTAACGCTGAAGTCTCTCTCGATCTGACACGACGACATTGGGATCGAAAAGAGCACCCGTACAGCTTTCGGGATAATGCGGTATTGTCCAGAATGCTC
GATTCGCTTCCAGAACTGGAGTACACTCTCCTTTGAAGCCATGTTGACGAAACGCTCAACGTCTACCGCCACCGATCCAGCTCATCTTCAGCACGCTTAT
CAACGCGGGTTGTCGCGACAGACCTTGTTCGTGGGACGAATCGCGCATCCAGCCGACTCAACGGAGCTGAAGATGCACTTGGTTGATCTTCTCCGCCGTC
TAATGTCCCGGCGACCATCCTCAATAGAGAAAGCAAGTTGGAGCGAATTTTGTCGTTAACCGCGGTTAATCCGCTCGCAGCCTCTCTACCCTTTAGTCCA
TGCTGCCGGCAACACAGTACAACCGCACGATTAAGGGACTCCTGGGTATTTTTGTAAATAGGGTGGGGTTTTAGCATCATTTCCAGCACGAAGTCACACT
TAGCAAACGCGGAATCCTTGTAATACCGAGAAAAGAATCCTTCATCCAAAGCTTCACGTAAGAGATCGCGAGTCTTAGTTGCTAGTGGTGTTAGTGAGCT
TGACGATATCCACTGTGGCTTTTCGTCCGTTGAGAGGTAGTGTGGGATAGCTTGACCGGGACAAAGTTGGTCAATGACAGCGACATAAGTACTTCCACCT
GCTCGGGTCGCCCTGCCTGAGACTTAAATTTTAAATCCGCAATCTACGTAAGAATCGAGAGTGCCTGGATGAGGTAGGTTTGACGGTCTTTGAGAGGGAA
CGCAGGGGGCGATCGACGATCACGGATAGCCTTCTTAGCTCAAATCTTGCACCATGCGACGATAGCTGCCCACTTGTCCAGAACCCACCGCATAGCGTTT
GTTGTGCTCAGGAAGCGTGAAACGGAATGCCTGACAAGGCGAGTTGACGCTCCTTTCGTCTTCGACTTGCAAAGTTCAGCAAATAAGTCACCTGTTGTGC
TAACTAGTTTCACGCTCGTAATAACGTTGGTCATGTTCGTAATCAATTCAGCCATTTCAGGGTTCGCCGCTTTGCTACTTCTTCCGCCAAGGCCACATGA
CATTTTGGTGGCAGCGGGAGCCATGTGAGCGAAACACCACTCCCAGCGCAGTTGAAGATCTGAGCACAGCATAAACTTCACGTCACCGCCTGCGTCGCTG
GCCGATCCGTAAAAATGCAGGTGCTTTAGGCCAAAGTCAACTAATGTACTGGTAAGCCACATTCGAAATGTTTTTTGAATCCCACCTTCACGTTCACTGT
AAGCGGGATTGAATTGTTTTGTCCCGAGGAGAACGGAGTTGAATTGCCAGTCCTTGTTAACTAGGTATACTCGTAGCCCCAGATATTTGTCATTCGTTGT
CTTGCACGTCCAAAAGTCCGCAACAAGTGTGAAATTGGGGTAAGGTTCTCGGTTGTCAGCAAGGTACTCTGTCATCTCGACTTTCGTTGCCTGATACAAC
TCAATGATGGCCTCTTTAACGCGCTTAGCATTAATAGTCGCTTGCATCTCCTTCTTGGCGACCAGCGCCTCCAGCAACTTCGACTCTTCATATTCACCAC
TTCTCAGTGGCAAATTGTGTTTATTAATTCTCAGCGCCTCCAGTTGTAAGATCAACCGAGCTGGATTGTTGGTGAACAGCGGCGAGGCTCGCAGTTTCTC
GGCCCTTTTGCCAGCAACTTCTACCTCTGTCTTAGGCGACGCAAGATTGTGGACCAGCCAGTGATGGTGTGACGCTCATGATGTTTTTCCTGTGGACATC
CTGAACAGGTTGTCCCCTGACGTTCTGCACGTTTCGTCGGCCAAGAACACCCATCTTGTCGTCAACTTATTATTTTCGTCCCGAAACTCGACGCGGACTC
CCCATTTAAAAATGTAGGAGGTCTCTGTTTCCGTGGGGGTATCACACGGAACGGTCCAACCGACCGAAA