Description :
From Genome Similarity Track
Location :
Scaffold_668:2706- 4154
Transcript NameFunction/comments
Phyke_g10663hypothetical protein

Sequence
1448 bases(100 bases per row)
AcattgtcttcttctcactgGCCCCAGATGCAAAGTTGGACGCGGCGACGCTCGTTAGCAAGCTGCAGTCTGATAAGGGCATCCTCGTCACCGGCAAAAC
GTTCGGAAGCTGCCTCCGCATTGTGACCAACTTGCACATTACTCCGGAGGACGTCGAGTACACGGTGGAGGCGATTCGTGATCTGTTGAACTGAGATCAG
CTACAACACCGTCGGACTGGTAAGCAACGCGTGCTTCGTATgccatgatgatgacaatgtGGCGACGGAGTGCTGCACCGTAAACTGATTAGCCTTGATA
GACAAAAAGCTGCGACGCGACCGGCAATAATGCAATTTGATCATGAAGGTATCTCATGCAGAAGcccaagcaccacacgaaCATTCCTCTGGTCTGGCTC
CACTGAAATTTGTCAACACGGCCCACCAAGTGAATATTCTTGTGAATGCTCGGATACGTTTAGCTTGTCATTTGTAAGAAATGTCTGAATGCCAAATGAA
CGATACTGCAGGAATACACGAATGGCGCATTAAATAGTACCAGAAACCGGGCTTCGATTGTCTATTCTGGTGCTTGGCCTTGCAACCAGTGCAACTCTGC
ATGCTAATCTTTCGCTACGAGACACGAAGTGAACTGTCCTTCAGCGACTGATGGTGTGACGACTGTcaagggggggggggtgtCAATTTGCCTCCAGCCA
TCCAGCCTTTGCATTGCCGACATTATCGCCCCCGTTTACCGATTATCCTGCTATAGatcaagacgacgacgaagctACAGTGCGTAATTAACTACATGTC
CGACACGATCACGTGCCCAACGCCAGGCATGCGCCAGGCCATTCCTGCTGCCCAGGTGGGCGACGACGTGTACGGCATGGACCCCACGGTCAAGCGCCTG
CAGAAGGTCATGGACGACCTCCTCGACAAGGAAGATGCCATGCTTGTGCCCTCGTacgtcagcttcttcgtttAGAGACTGTTTTGCAAGGTTACTGACT
CTCATATACCTCTTATTCATTCTGCAGTGACGCAATTTCCAATCTCATCGACATCGGTACACACTGCAATCGCGGCGACGAGATCATCTGCGGCAACAAC
GCGCATATCTTCTGCTACGAAGGCGCCAACGCCGCCGGTAAAAACGCGTCATCTACACCATGAACTATCTGCCAAACCTCAGAAGCTaacttgaagtgga
gcaATGCGTTTTTGAACATGTAGCATACATGGGTGTGAGCCCCGCTATTCTCCCCAACCAAGCGGGCGGTACGATCAAGCTCAGTGACATGGCAAACGCT
GTCCGTGCCAACGACATTCACTACCCGCGGACAACTTTAGTGGAGACCGAGAACACACACAACACCTGCGGCGGTCGTATGCTTCCCCTGTCATACATTC
GTGAAGTTGAGCAATTTTGCCACGACCACGAGCTGAGACTGTAAGTGG