Description :
From Genome Similarity Track
Location :
contig_66:27056- 28325
Transcript NameFunction/comments
g9560.t1hypothetical protein

Sequence
1269 bases(100 bases per row)
CTGGGACATGCAAATGACTTTCTGACGCAACGCCCAATAACGCTGTTGAAGGACACATTCGTTATCCGGGGGATAAAGCGGTGGCGTATGGCTTCATTGA
AAGCTTCCCAAGACTTGTTTCTACCCGCCGCACTCGATTGAAAATTGGCGATACCAGTTCATAGTAACCACCTCTAATGCATAAGATCATGATCAGGAAT
TGTGTCGATCCCTCCACCATATGTGGATGATAGTCAACGTAGTATTGCTCGATAAATAAGATGCAGAGCTCTAAGTCCTCCGTGATTTTGCCTTCATACT
ATGTTTGGATGTTTGTTGTATGTCCATTGCACAAAGCAACAATATCATGCCGTCTAATGCTACAAGGAAGTCGAATATATGATGGCTAAGCTGATCGTTC
TTCTGAGCGGTCGAACGCTCTGGAAATGTCGATCGGAATATTGCCATCAATCTCCCAAGTTGGCTCGGGCTAGCCAACCCACTTAACTCAGTATAAATAT
AGTGTGCTCTGATATATAGGTCCCACTATCTGAGGTGCTGTATGCAAAGAAGTTAGGTAGAACATCAAGTTGCCGATTCATGGATGTTCTGAGCTCTGTG
ATTGGTAGACTTCAGATTGTTGATCGTTGAACCAACGTGTATGGCGTATAATACGTCACAATATAATAAAGGAGGCTTAACCACGCGTTTGGTTGGGAGG
CCTTCGGTCGAGGAAATCAATCACTTCTGGGTTTCCCCGCCAGCCTCCAGCTACCTTCTCACCTTTTCTTCCGCCACCGCAATGTCAGCTTGATACAATA
TTACGTTTGAGTAAGATCAACTAGTTCACAGAGAAAAACATAATTGTGGGCCTTTTGTTACAAGAATTGGTAGATTTCCTCAAAGTATTAAAACAAGATT
CAAATATTGAAATACAGCGAGAGCCAATGTTACAGGAATATTTAGCCTTAATATTTTGGACAAAAATTCAGGTTGAAGCAGTTAGCACCGTGAATCCCCT
TTAGGTACGAATATCGCCTCGCGCATTATTGAGCACAAGTTTACGGCAGCAGCATGCGCACGGAAGGCTCGAGCGCGCGCATCAAGAAGAAGAAGCGCTC
GTCGGAACGCTCCAAGCGTCACGACAAGAGCGCGGACGAAGGAGAATGGAAGCAGTTCACGTCCCCCGACGGCCACCCGTACTTCTACAACGCCGTGACC
AAGGAGAGCAGGTGGGAGCTGCTAACAGAGTCCGTCCGCTCCGAACACCGGCAGGCTACAGGGGGCAAC