Description :
From Genome Similarity Track
Location :
Scaffold_33:270487- 272160
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010923Similar to WEE1: Wee1-like protein kinase (Oryza sativa subsp. japonica)

Sequence
1673 bases(100 bases per row)
CGGAACGGGAGAACCACTTCGTGCTGCAGAATCTCTTCCGCGAGCGGCCGCTGCAGCGGGTCTGGGTGCATCATGCTCGCTATCAGATGCTGCAGCGAGT
TTGAGTATTGCCTGCAAGCATTTTCACATGCCCCACACACGATTTGCTAAGATGCTTCTCACATAATAATCGCATTATCTACTGCAGGACACGTACCGAA
ACATGGCGAGATCACCGTCGCGGATTCGCTGCCAGTCTTCGCCTCCACTCGGGAGCGTTGACCCCAGCGCGAGTTCGTAAATCGTTGCGCCAAGTGCGAA
AATATCACCCGCTCGCAAATCTGTGCGACTTCCTTCCAGCAGCTCCCTATCGTGTAGGAATGTTACGTGAGTGCTGCAAATATCTGGTTTCAAACAGAAC
ACAATAAGCGAAATCGTACCGACTCAAGTACCGGTTGTCGCCCTCGGTGATCTCCATACTGCCGTCCATGTGCGCCACGGTGCCCAAGTCCCCGAGCTTT
ACAGCATATACAATTCAGTATCTTAGATTCACTCATGCATGGAAAATTCTCACCGAAACAGTTAGGCTTACCTTGTAGATGTCTCCCTCGGCCACAAGCA
CATTCTGGAGCTTGACATCCATGTGCACCATCTTCTTTGTGTGCATATCGTGCAGTGCCTATTCGAAAAAGCACACCAGGGTTAGACGCCTAACAGAGAA
AAAACACAATTGCTTAGTGTATGCGTACCTGGGCGATATGGCAGAGCACTTTGCAAAGCGTGGCTTCGGGGATGTGATGTGGTTTGAATTTGTCGAGCAT
GCCGCCAAGACTGCAGCCCTGGCAGTTCTCCAACTGAATATAGAGCAAGTCGTCCTCGATCCACGCGTCAAAGTACCGCACGACGTGGCGGCTGTTGCTC
AGCGCAGCGAGCGCCTGGACTTCACGAAGCGCGCGCTCCGTGTCTGCTTTGCCGCGAAAATGGCGCTTGCTTTTCTTCACGGCGTACACCCACCCGTCTA
GTTTCTTCATGCACTTGTACACTTTCGAGAACGAACCCGAGCCGAGCAACTCCAGTTCATTGAAATCGGTTAAATATTTCGACATCGGCGCCGCAGTCAC
GCCGCTTCCCCATGCCGCTGGGAACGACTGCCGCTTGCGATGAGATCGTTTCTTCTTGGAGTCTGACGCCGGTACGGGCGCAAACGGGTTGACAAACGAG
TCCATAAAGCTGTTGCTCGTCGCCGTTGTCGTCATCGTGCTGCTGCCCTTTACGGCATTGCTATCGTATCACCAGGAAATATTGACCCGTTAATTCCTAC
AAAGCCATGTATGCTCACATTGAATGTCCCATTTCGTACCTTATTGGCCGCGATCGCCGTTTCCCAGGATGAAAGCTCTTCGCTGGTGTGTCGCTGAACT
GCTGCGGCGTCGACGGGAACATCTCGCGCGGCGACGGCATCGAATCCGTTGAGAAACTTGGCGGCGGCACTCCCAGACGATGACAGACGTCCATGTGCGT
CATGTCCTGCGTCAGGTTCTGCACTTCTTCCTCGCGGATCATGTCCACGTTGTTGATGGAGCCATCGTCGCGGCGCTGGCGTTTCTTCAGCGGTGACGGA
GTCGTCGGGTGCGACAAGTGCATCACGGGCTGGTCCATTGGCGTGAGGAAGTCCATATCGTCCTGACTGTACA