Description :
From Genome Similarity Track
Location :
contig_47:270480- 279689
Transcript NameFunction/comments
g7871.t1hypothetical protein
g7872.t1hypothetical protein PHYSODRAFT_495212
g7873.t1hypothetical protein PHYSODRAFT_491292
g7874.t1hypothetical protein PHYSODRAFT_259733

Sequence
9209 bases(100 bases per row)
TCTCGCCCGAACAAGCGAACCGAGGAATGGCGAGAGCGACTGCAACGCGCACGCGCACGCGTGCCGCCAAGGCGCCCGCCGCGGAAAAGAAGCGTCGCCG
GGCGCCGTCGGACTCTTCCTCCGACGATGAGCAGGAGCTTGAACTGAGTGACACGCGCGCGGCCGGGGCAAGCGGCAGAAGGCCAGCGCCATCCTGACCG
AGTTCACGAGTCTGGACGCGCTGCTGAGCAACGACCTGGCGGAGAAGCGCAAGCGCCAGAACCGCGAGCGCAAGCTGCAGAAGCTGCGCGAGGAGAGCGA
GGCTGCGGCCAGAGACGCGTCCGAGGGCGGCTCCTCGCCGCTGGGGAAGCTCATGAGCCACATGGCCAGCAACATGTCCACGCTCTCGGGCGACAGCCAC
CTGTTCTTGGGCTCGGAGGTGACGGTAGCCGAAGAGAAGTTCGGCTACGTATTTACGCCCATTACAGAGGTGGGGGGGCACTGAAGGGCTCGTGACGGGA
TGATGTATTGACAAAAAGTGTTTTTTACGGAGTAGCCTCTGCCGTATCGCACGTACAAGGCGACGGAGACGGAGCTCAAGAGCGACCTTAAGCTCGTGTA
CGCGGTCATGCAATCCACGGACGACGCAGAGCTGAGCGGACTGCTGTGGTCCAAAGCCATTTTGATCCGCTGCATGCTCACGCAGCCGACTAAATCGACC
ACCAGAACTGCTGCACACCGACACCGGTGGCGCTGCCATCAAAGATAGGATCGTGGTTATTTATGACGAGTAGGCTTGTTGTGATGCCCGTGAGAAGGAA
ATGTCGGCTGCCGGCTCTAACGAGTGCTCCTTGATTTGCTTGTGCAGTGTCGACGCATAGCGACAGTCACTAGATGCTTTAGCAATCTCTTTCTGATGCT
GAGCTCGGTCAACAAGGCGTCCATTCCGAGATTGAGCGCAGCTCTACCCGTTGCGTGTTTTGCCCACCCAATTGAGGATTTCCGCTCGGCTTTTGGCACC
CAGGTCCCAGCAATTGAAATGGAGTGGAAGCCGACCATCTACGATTTCCTCAATGCCTTCCGCGCGTATGGTTTTCAAGACAGTAAGCGATCCATGAGTG
TGAAAAGCAAGATCCCGGTGACCCCGCCGTCGACGAAGAAATTGCGCGTACTGCCTTTCCCGACCCTCAATATGCATTACGTGCTGATGTACTTGGTGAT
TTGCGCACGAAAACACTGACGCTGGAGGGCTACGATGCCTTCAGTTTCACGATGTTTTTTTTGCGTATGCAGTTTGAAAACGATATCCACGCCAGTATTG
TAGACCTGGCCACCATTTGCATTGAAGAACTCCTGGATGTGTTCCCGCGCGCCGAGTGGCGGAGAGAGTGGGCGCCGCAGCTTGTTCTCCGCATCGCTGG
GGCCAACGAAGGCTTGTTTGACTCGGCAGCTGGCTGGCTCGCAGTTGCACGTCGACTTCCGCGCACAATGCGTGGCACACAACTCACCACAGGACTGTCG
ATCTACGTCCTGCAGCACCGAATCGACATAAAGCTACTGGAGGGGGTACGCTAGATTGTGCTCCTGGTACCCTGTTGTGTGTCGCAGTCGCTAATGTTGA
TTTTTATGATCGTTTTGGATATACAGGCAACGTCCGAGAGGCCGTTAAAGTTTCCGATCCAGAGTGGACTTGTGGTGGACATCGTTGCTGGTATTGTGCA
AGATTTGACACTGAAGTATGCGGAAACGCGCAAGAACGGCAAGTTATCGAAAACCACGCCGCCGTTTGATCTGCTGTGCAAGAAGGTGGCCCTGATGGAC
CTTGCACTACAGGCATTCCTCAACATCCTCACACCAAAAGAAATGAAAATCATGCTGAACAAGCTGGACCAGCTGGCTGACGCACACAAATCGACCATGT
CAGCCAAGTGGCACGAGCTCAAGACACTTGTAAGTCTCATGCACCGCAAGTACTCGCTTGAAAATTTGCGCATAGGTCGGAGTTCTGCTCCTTCAGCGAA
AACCGAGCTGTTTTGTGACGACGACGATGAGTAACAACATTTAGGGACGTTTGTTGAGTCGCAATGCGGCTGAATAGAGATTAACTGAGCACTGGAGCTT
GTTATCGCCCTATGCGCGGTCGCACCGTGCGAGCTAGTGGCGCTGCGGTTTTTATCTTAGTATGCTGCCTCAATTGTGCGATCACCTACAAACTCATCAA
ACTATTGCTGCTCTTGGACCAGTGCTGCGTACTGCTTCTGCAATTTGACCTCGATTAGCTGTTGCGAGTTCACTTCGTTTGCCAGTCGGGACATACGGCT
TTGCAGCGCCTGGGCTTCGACACTTGCCAGATCCTCGAAGCACGCCTGCTCGATCGTAGCGTTCTGAAGCTCAGTCATGTGGCTGCGCAATGACTGCAAA
CCCTGTTCCGAGCGGCGGTAAAATCCACCATTTACGACCCGCGCCCGCTCGCCCAGCTTCTGCGCTCGCTTGGCAAGGAACTGCTCGGTTTCCTTCAACT
CCGCAAAGCGAGCTCGCACGGCATGCAACTTGTCCTCGTCTGATGTAGCAAATTGGAACGACACACACCGTTTGTACCTTCGCCGTCAGCTTTGCGTAAA
TAACGCGCTTGCACTTCCTCCCATTTAGCGCCGAGAATCGAGGCGTCCTGAGATTTCCACACGTTGTTCACGCCACACAGACTGGCCTCGATCTGCACCA
TTTGCCGCGCGTGCTCCATATCACTGTCCGAGAACTGCTGTAAATGCGGCACTGCCACTGCGCTCGGAGATTTTTTGCGCTTCTTGCTCTTCTTGGACTT
GCCATCATCTATGGGATACTTGGCACGATCATGCTCAAGCATTCGGTACATTTCGTCCGCTACCTCGGTTATTGCGCTGTGAATCAACACCTTTTTCACC
TTTGTAGGACGAGGAAGATCCTTTTGCACAGCAGATGAACGCCGTTTAAGTTCACGCTCTTTTTCCTGCTCGCGCTGCTGCTGCTCACGAGCCTCTCGCT
CCCCAGCATCTTCCTCCTGAAGGCCAGTGACGCGGTCATCGTCAGCTTCCTCCTTCTCCGGAACATTAATTTCATATTCATTCTGAGGCGCGGGTAAGCT
GTTGAAACCTTGACGCAGACTGGCTGCCAGTCGCTTTGCCCGAGCCTTTTCTGCCTTGGTATTCTCAGCCTCTGTACCATAGAGTTGCTCCGGGTTGATG
CCTAACTCATCACGCAGTGGTGTGCGTGTGGCAGACAGAGGCGTCTTGTCACCGACTCCACCAGCCATTGCTGAGGATGGTGTCCGGGACGGAGTAGCAC
CCGCATAGCCTGTTCCTTCGTAAAGCTCAACATTCTCGCCGCCAAGAAGAGGAGTAGCACTGTTTCGCATGGCCAGCAGATTGGCGGTTTCCTGCATAAT
ATTATCGTGCACGTCGCGACTTGATGGCGTAGCTGCAGGGCCTCCAGTAGCGGGATGAAGCGGGGTGGCACTGTAGTCACCCATAAGCGAACGCGTCTCG
GTAGCTGATCCGTTCTCCAACGCAAGCGCAGCTGCATGGGTAGCGTGCATCCCCAACTTAGCGAGGTCGCTCAGCTCCTCGTTCGAAACCACAGGTGCGG
GCAGCTCCAGCGGAGTGCGCTTAATCGCGTTGATGGGGTCGTTCTTCTCGTTCACCGCAGCGATAATCTGTGGCAGGTTGGATTTCATCAGCGATTTTTG
TCTCTTGGCATCCTGTTTGCGCTCCTTCTTCTCTTGAGCGTCACGGCGCACGCCTTCCAGCTTGTCCAGCTGCAGTGCCGCCCGCTTCGGGTCCAGGCCA
TTGCTGGAGATGCGCTTCTCCTCCGCGACATCGTAAAACCCAGCGGGGGCCTTCTTCTCGAATGGGATCTCGCTCGCGTAGTCAATGTACTTGCGCTTCT
TCATGTGCACCTTCGGGTTGGACGACATGACTCCGGCAGCCTTGAGTTCGCGCTTCTTCTGCAGCGTAGCGAGGCGTCGCGCCTCCTCCAGCTGTTTCTC
GCGGGCCTTGCGCTTGGCCTTCTTGCCCTTGGTGTTGGCCAACCGAGCCCTCGCCTCCGACAGCATCTCCTTCTCGTCTTCGTCCATGTCCACAGGATCG
GGTCTGGCCGGTTTGTTCTCCGGATTGGGGTCGATCTCCCCGGCGCGCAACCGCCGCGGGTCGTCGCTCACGTCGACGCCGTCTTTGTGTTGCGCGGCGT
CCAGCAGCCGCTCGTAGTGCTCCATGCACTGCGCCGCGGTGCGGCCCACGATGGGGGCGATGGTGCGCCACTGGGAGGGCATGAGTTTGACCAGATGCAA
CAGCTTCTCCTCCTCCTCACGGCTCCACTCGGTCTTCCGGATGCTTGGGTCCAGCCACTCGTACCAGCGCGCCTTGCACTGCTTAGCCGACTTGCGCGAC
AGCAGCGACGCCACGCGCGCCCACTGGTTCATGCCGTACTTCATGACGGCCGCCTTGAGGATCTCATCCTCCGTGTTCTTCCACACGCCGCCCTTGATCA
TGATCCGCATGGCTGCCTGCGGGGGGAGGCAGCGACAGCGACGGATAATGGAGCGAAACGAGTGGTGTGCGCACATCACATCGTATCGTGTATAGTTGAT
GTGGTACGTATCTTTTCGTATTGAAGTTGTCATGGCGACGATGGAGCAGCGAGGGCGCAGTCTGCAGGCGGCGCTGCAGTTCATGGAGCGCAATGGACGC
GCGCTGGAGGAGCTGGTGGCTAGGATGTTGAAGGCACGTGAGGAGCAGGAGACCTTCCTGGGCGCGTTCGCCAAGAGTCTGGAGGATATCGCGGCCCAGG
AGGAGTGCACGCCGCTGGCGCAGGTACTGGAGAGTCTGGGCGACTGTGGGCAGAAGCTGGCGAGCGAGAGCCACGACATTATGATGCTGCGACCCGAGAC
GGAGATTTTACAGGTGGTCACGCAGATTCAGGACTGGGCTATTGTGCCCATGAAGGTGCGGGGCCTGAAGAGCTCGAAGGAGGGTAGAAGAGAGAGAGAG
AGAGAGAGGGGTCTGACACTTTGGACTACTGCAGAGACTGCTGGAAGACCGGGAGAAGGCAATCAAGATTGAAGCCAAACTACAGAAGGAGTATGACGAG
ATGAGAGTATGTGGGAGAGCTGTGGAGACAACGGTAATGCAGGTCAGACACTAATGTATTGGTGTCTTTGTCCTGGTTGAAGCGAGGAAGCTCGGCAAGA
GAGAAGAAGCTGCGGATGCTATCGGACCAGAAACGGCGAGTAGAGAATGTCAACGCACTGCTGGAGACACACATGGAGAGCTTCGACCGGTATCGAATTC
AAAAGATGAAAGTGCGTTGGTATCGCCTCTCAGCTACCGCTCTCGCTAACCTGCTAACCACTCTAAAATCTACTACTTCGCAGAAAATTGTGAGCGAGTT
GGCTCGCTCTCAGGTATTCTACCATGCCAAAGGACTGGAGTTATTTGCCGTTCCGTGTCAAACCATCGCTAAGCTCGATCCCTTAGACGCAATGAAGGCC
ACTGCACAATCCAACCTACCGATGCTACCTAGATGGGTCGGACAAGCAGAACTTTGGTAGCATCTCGGTACCAATCGTAAGCATTTCATTACCTGTATTA
TCCTTGTCTTGCTAATCGAATATGTACAGCGCGACGTAACTAGATTGCTGAGGAGCGGCCTCTTTCTCGCTCCTTTCTGCGCTTGCTGTGGCCGAGCTTC
GCCATGCTCTCTTGCAACTTTCGCCAAAACGACCCCCTCTCGCTTGGTGTTCGCTGTGGGCTCTCCGTGCCAATACCAAATTGTTGGCGCCGTGAGATTC
CAGGCGATGCTGTCCAACTTTGCGGAGAATAGCAGTAGTCCTCCAGCAGCTTGTCGCTGTAGAAACCTCGTTTCTGCGTCATGAAGTGTTTGATCAGTCA
GGAGTACATAATTCCACAAGCACAAGTCGGTCACGCACCTCTTCGAATTTCTCGTAAACCAAGTGCACAGGCACATCTAAGTAATTCGCCAGTCCGAGCT
GCAAGCTGCAAAGTACGCATGCAAAGCATATTGTTAGCTGTTGTACCGATCCAATTGCACCCAGATCAGCCTGGCGGATACCTCATTTGCACCGGCTGAA
GAGATATTTGTCGTCGAGAAAACGTGGGGGTCGCTTGGGACACAAAGGATACACCGTAGTCCGACTGCATTTTAAACAGTCAAATTGATGAGCCCGCCTG
GAATTCCACTCCCAACATATACCCACGTCCCATCAAACTGACCTGTGGCTGGTGCGAGAACTTCACGGAGTGCTCGTACATGTGTCGATAGACAGCATCT
CCTAAAGATTCAAGCTCGCTGCCGCGTTCCTCGCAAAGTTGCACTCTATCAATGAACGATGTCCACTGTTGAAGACAAAGTGTACGTTACAAAGTGCGAC
GTCACAAAGACCCATACCGGGGTACCCGGTTTGATACTACCACAGCAAGTTTCATTCTGCACGCACCTCGGCGAGAGTTTCTTCAGCGGTGTATTTGCGA
ATAAATGGATGTTGGAGCAACGCTTCAGCTGACGGTCTGTCGTCTGGGTCAATCGTAAGGCACTACACTCATACCCAATGGGTACCAGTCAGTATACACA
CCAAGCACAAGGCTTGCAAAAATGAACGAACCTGATCGGTGAACGAGCGGCATTCTTCAGAGTATGCTTCAGCCGGCAACTTCAGGCATTGTTCGTTGCA
ACCTGAAAGGGTGTCAGTCTATGTTGTGAGTACGCAAGTAGGAAAAGAAGGCTGGACTAAAGAGAAAACTCACGGAATCAACCAAGCCGAAAAATCCGTC
CTGCGTCGGAAGCGGATAGCGGCCCAGAGCAACAGATATTAAGGCGAGTCCAAAAGACCAAACATCGGCTACAAAAACAACAACAAGACAGAAAATTCGT
GAGCACGCTGTGACTAGGGGCCACATCCCACGCACGACTCACCAGGATAAGAGTAATCACCGCCACCTATCCGCTCGGGTGCCATGTAAAGTAGAGTACC
CACAAATGTCTTCGTTGTGGTGGAGGAATCATTCAGTGTACGAGCCAAACCAAAGTCCGAAATTTTGACATCGCCTTCTCGGTTTGTCAGCAAATTGTGC
GGCTTAATGTCGCGGTGTACCATCCGCTTGTTGTGAATATGAGCTAACCCATGTAAGACGCCCGACGCCAAGCGTGCTAGAACCTTTTCGTTTTGGCAGC
CACCACGCAGAACAATATCTTGCAGTGACCCCGTGCTCATGTACTCCATAACCATGCAAATTGAGTTTTTTGGGCGATCGACAAACGCATCGTAAAATGA
CACGATGTAAGGGCTGGGCCTGGAATATATAAAATAACAAAGCCCTGTTAGTAAAACACGCACAAGCGTATTCTGGGGAAAGCAAGCATATTCGCCAGGT
AAGACGCATACTTCGCCTTGGGCTTGTTGGGGCTGTTTCCGGGGTATCGTGATACGGCATGGGGCTGTCGTTACTTCCCATGGGAACCAGATTAGAGTAC
AATGCATGCAGCTCGCGCACCATTTGCCGGCGTTGCCCTCGTCCGTACACAGGAACATCCTGTATCCCATATTTACAATATAAGCACAAAGTGGATTTAG
CAACAAGACCAACTGTAGGCAGAGCACATCGTAAGAACTCACCTTGACAGCGACCACTTTCAGCGTGGGAATGTGAATGGCCTTATAAACTACCCCGGAG
GCTCCTCTACCAATTTCTTTAACACGCTCGAGATTTTCTTGCAGATGCAGGCATGCAGCATCCGGTGATGAAATACCCGCTTCCGACACTGCCACATTCT
TGGTCGTAAACATGCCATGATTCGGTGAATACGCACTCCCAGCACTATGCCGCCCACCATCTACAGTACATCATTAAATTTAAAGTCAACAGAAGTGAAG
CATCAATAGTTAGCAGCGCCCGACTCAAAAGTCACAAATCGCATGCGGACCGCACCGTTTGGAGATTGAAGGTCCGACTCTGAGCCGGAACTGAAATTTA
GTTTCATCATCGCCTGCTGTGCGGCGCTAGGGCCACTCACAGGAGTATTCGATCCCGACGCAGCTGCAGCAGCAATTGCAGCTGCCTCCATAGCATCTCG
TTTCGCAATAAGCCTAGTAGCTGCTCGCTGAGCCCGCTCCTCCGCTTGCTGGGTGTGGGCATATCTTCAAGTTTGAGTCGAAGCTGGGGCCGCTTGCCTG
CACGGGCACTACCTGGGGTCCTCTTAGCAGACTCTACGGTTTTCCATTGCGGTGAGCTATCGCGAGGAGTAGATACTGGTGGCGGTGTACCTGTGGACGA
AGGCGATTGCGCCTGTTTTACCGGCGACAGTGGTTGAGGCCGTTTATCTTCGAGAGTGAGTTGGTTCGCTAGCGCATCAATTTCTTTGTCCAGTTCGGTC
ACAGTATGGTCGGCATTCTTCTCCGTAGCAGCACCATTAGTCTGATGGCAGCCAATGCTACGAGCCGATTTCGGCGCTGGAACGGAAGCATCGCCGCGTG
GACGAGCAGATGCCGATGTGATTTTTGCAGCCTGCGAGAGCGATTCCCCTTTGTGCGGCTGCTCCAGCAACTCGGTCGTCTCCAGAGAAACCAGAAAATC
CTTGTCCATCCACGGACACTCCCACGACTTGACCTCTGCAATCCGCAGTTCTCGCGGGCAAATATCCGGGAAAATGCGTGCGATCACCTCGTCGTCCGCC
TATCAACAGAGCAACAAGACACCACATAAGTCCACATCTCCTCAGTAGCTGAACATTCTCCTCCGGCACCTGCTTGGTGAGACTCGGCGCCGATTGCGGT
CGCATCAGCGTGTTCTTGTGCACGAGGAATGTCGCATGGTGCGGCGCCCGACCCGCCCGCAGCAGGATGGGACTGGCGCCGTCCGCTGTGTTGGCGAAGG
GTGAGCTGTTGGATTGCAGAGTCGTGTTGGCGGCCGCCCGCTCGCGACTCTCACGGCCCTCGTAGTTGGCGCTCTCCACGCGGCCGCGCTTGCGGAATCT
CTCGAGGAGCGTCTGGCGCGAGACCTCCTCGATGGAGCCGCTCAGCAGGTCGCGGCGGTGGCTGGAGGAGCTGCTGCTGCTGGAGGCCGCTGACGGAGGC
GACGTCTCGCGCTGCGCCGCGGGCTTGGACACGTGCCGGTTCTTCTTCATCGTGAGCTGCTCCGGCATTTGACTTGCTGCTTACGATCAAGCCCAGGAAG
TGTATCCCC