Description :
From Genome Similarity Track
Location :
Scaffold_27:270443- 271729
Transcript NameFunction/comments
Physo_133659hypothetical protein
Physo_133660predicted protein

Sequence
1286 bases(100 bases per row)
ATGCGGACGCGCCGACCGCGACGTCCACGAGCTGGCGCTACTGTCTCCACATTACCTACTACGGTACGGGCTTCGTGGGGTGGCAACGACAGCAGCAGGC
AGCGAAAAGCAGCTCGGGCCATGACAGTGTGCAGGAGGTGGTAGAGAAGGCTGTGACGGAGACTTTGGGGGCCTCGCAGCGAGTCAACGTCACGGGCGTC
AGCCGCACGGATGCAGGCACGCACGCACTCTATGTACGTGAGTTTTGAGAGCAAACTGGGAAATGTCGGGGTGTTTTTACTAAAGGGTGTATGCAAAATG
TGCATTCGTAGCAATATGGTTTCATTCGACTCGGCTCGGAGCTGCCGATGTCCTTGGAGGAACTGAAAGATCAAGTCAATGCCAAGTGAGTAGCAAAAAA
GAATGTCCTCGACCTTGTAGTGCTACGTTACAGTGGTAGAGTGACCGCGTGCTGTCTTGCTATGCAGACTGGGAAGTGACCGAATTGTGGTGCTTGGTGT
GACGGTGCCGACGACGGGCCCGGCGCGGATTCGATCGCGGTACAAGAAGTACATTTACTACTTGCAGCAAGGACACCGCCCGGACTTGGAGCTGGGCAAG
TACTCGTGGTTCCTCGGTAGACGCCTGGACATCCAGCGGATTCGTGATGCACTCAAGTGAGTTGAAGATGCACCGGTGGTTAATTAGTTTGCGCCTGGCA
TGAATTTTAACTGGTTTTGTGCCTTTGTAGGTATTTGGAGGGCACGCACGACTTCCGTCCATTTTCTCAGGGGCTGTTGAAGCCGAAGTTTGAGGATCTA
ACAACGTTGCGAACCATTATTTCCGCAAAAGTTGTTGTTCGACGGTGGGTCTTTTGTTTGCGCTTCCGAACATGTGCGTAAGTTACTATAACTATGCATT
ATGAATAGGAACGTGAACTTCTCGCTGGATCCGCAAGTGTGCGGTAGTGGCGAGGTCATTGACGTTGCGGATATGTACAAAGACCCTCCAAGCAATGCTA
CTGCAGAAATCCACAACTCGGACGGCACCAAGGCTGTAGCCACAGGAGACCATAAGAAACGGAAGATCGAGCAAGCCAAGGGAGGAGCACCCGTGCACTT
TGTTTGCATTGAGCTCGTTGCCAATGGCTTCCTCCGGCACATGGTACGACGGATCATTGGCACTTTGCGTCCAATTGGTGAAGGCACGCAGCCACCTTCT
CGAATGCAGCAGGTACTAGCAGGTGAAGTCCAGCCTGGTCCATCTGCCCCTACGAAAGCTCTGTGGTTGCATCGTACTTGGCTCAC