Description :
From Genome Similarity Track
Location :
Scaffold_115:27040- 29326
Transcript NameFunction/comments
Phypl_g3461hypothetical protein

Sequence
2286 bases(100 bases per row)
CGCTTGGGGCGAAAAACTCGCTAGTGTCGGAGATCGAGATCGAGGATGTGCTTGAAACAGCGGAAGCTGTGCGTCAGGAGTATCATGACTCGACGTGGGG
GTACCTCAAGACTGCTACGACGTTGCTAACCTTCCTATGCAATTCAGATGACGGCACCTCAGCTTCAAGTAAGGGCCGATCACTTGTCTCGCCAGGACTC
AGCCAGCTTGTGAAGGTGTTCTACCCATACTTGGTTAACCAGCCCCGAGAAGAACTCAGCGACAATTGGCACCCAGTGAACAGCGTTTTATCAGCAATGG
GACTGCCCATCGATTGCCTCTACCTCATGTTGGACCCGATGGGCAAGATACTTCTCCTTGCCGTAGAGTTGTGCAGCCGATCGACTCAAGAGTCCCATGA
TAAAGACGATCTCGCTGTCTTTCCTAAAGTCACTGTCATCTGTGATCGCGAGGATGTATTGCAGTCGAGTGTCGAGTACGTTTGGCGCAACCACCTTTCA
TCTGACAAGGCGATCTCGAACTTCTCCCTTTTCCCGTTCTTCAAGAGTTCATTCGGTGAAAAGCTTGTGGATGGGGTAAAggtcgaagaaggagaaggaa
agGGCCCACTGAAGGAATGGTTTACACTTGTGGGCTCTcagctggcgtcgaagtgGAAACATGTACCGACAAGCGAGATTTTGGCGGAGGTAGACTCGAC
TCAGGTAACTGCAAGTGGCAACGGGATAACAATTCCTGGGGGTTCCAAGATTATTTGTCCAGGCTTCCAGCTCGAATGGGAGACGAGCGAAGGAGAAACG
ATCCGCCGAGTTGTCAACAAGAGCGTGGAAGATGACACTTTCCTACTGGACCGGAGTGTGCTGTCCCATTCGTTCGTGGCATCTCAGATGCGGATTTCAA
GGCCTAGCAGTGCTGTATTCGAGTATGTGCAAGGGTCCGAGAGCTACTGGCTCAACGAGAACACACGCGAATCACCTGAGACCCGCAACGTGTTAGTATT
TGTAGGATGGTTCCTTGCTAGCGCTGTTACGCACTTCTGCTCGATCCAGTTGCGGATACACCCTCTGTTCTTCCGGTTATTGCTGAGCCCTGGGCATTGT
GTGACGCTGGAAGAGGTTCAAAGGTTCGACCCGCAGTTATTCAAGTCGTTGTCCGGGATGAAAGACATGAAGCCGTCAGATTTTGCAGAGTATCTGAAGT
TCGAAGGCGTGGACGAGAGTCTGAGTGTTGAGGCGTACATCAGCAAAATGCTAGAAGAGAAGTTCAGTCCAGCGTCCGGGATCGGGTGGCAGCTTCAATC
TGTGCGTGGTGGGTTTACCCGAGTCATTGGCATTGACCAGCTTGGTCGTGTTGGTATCGCTGAGGCAGATCTGCTGGAAAGCATTTGTGGAAGCAGCGGT
GGATCTGGGGATGATTTTGTCATCAGTGAGGTTTTCCGAGTCGCCGCCGATACCGACTTCACAGACTGTCGGCCCTTGATGAATGCGTTCTGGCAGACGG
TGAACGCCTTCGAGCCGCAGCTAAAGCGGAAGTTCGTCAAGTTCGTGACCGGAGTGGATACACTGCCCCTGGCTGGCTCCGAGGTACGTTGACGCGTTTC
TCTATTGGTGTCGCCGAACTGTGCTAACTCACATCGTGTGCTGCTGTAACCACCAGTTCTTACGGATCGAGATGCCGTTCACTGCGATTTCTTCGGAAGA
TCACGAAAAGAGTCTACAGATGCTCCCTCAGGCACATGTACGTGGGGAACGTTTCTACTGTAGTTGATGCAGCTTGCTAACTTGACTCTTGGTTCTCGTC
TTCAGACTTGTGATaacacgctggagctgcctcATTACTGGAAGGCACTCTGCTGGAgggagcagcacgacgagcacgaagcaAGTGTcaagctggaaga
agagctggcACTTTTGTtgggcaagaagctgcgcgacgcaGTGGAGTACTCAAGCGGATACGGGCTCGACGGCACGTCAGCAGTGGCAGGTGTGCTCACC
GACAAGGCTGAAGAGAACCATGATCAGTTTGCAAAGGAGGAGAGTTACGACTCGCTGGATCTGCCGGCTCTGTCGGAAGACCGAAGTGCCGCCGAGCTGC
CCATTGAAGACTCGCCGGCGTCACCACAGACGTCAGACCacgccgaggccgagcaaGAAGAGGCAGTCCCAGATGCTGATGAACCAAAGGCCAAGCCAGC
AGAAGCACCCGCCGCGGCCGTGTCGCCTCGTCCAGAGGAGTCGtacgacgagtacgacgacTGGGAGGAAGAGTCCGTGGCGTGAG