Description :
From Genome Similarity Track
Location :
Scaffold_66:270396- 277722
Transcript NameFunction/comments
Phyra_52148NADPH-dependent diflavin oxidoreductase, putative
Phyra_96192DNA primase, catalytic core
Phyra_71986HECT E3 ubiquitin ligase, putative

Sequence
7326 bases(100 bases per row)
GATGCCTCGCTTGCTGGTACTGTACGGCAGCGAGACCGGCACGGCGCAGGACGTGGCCGAGTTCGTGCAGCAACGAGCCTTCAACCGGCAGCTGCTGGAC
ACGCAGATCTCGCCCATGGACGCGTTCCCCGTCTCGCGGCTGCTGCCGCAGTGTTCCACCGTCGTATTCGTGGTGTCCACGACAGGCGACGGCGAGGCAC
CCGAGAACATGCGCAACGCATGGCGCAGCCTGTTGCGCAAGACGCTGGGGCTGCAGTGGCTCTCGGGCGTCCGCGTCGCCGTCTTCGGACTGGGCGACTC
TAGTTACGCCAAGTACAATGCTGTGGCGCGGAAGCTGCAGGCTCGACTGCTGCAGTTGGGGGCGTCGGAGCTCATTGACCGAGGTCTCGGGGACGACCAG
CACGCCTATGGATACTTCGGGGCGCTGAACCCGTGGCTGGAGAAGCTCTGGGCGGCGGTGCTGCAATTGCATCCGCTGCTGGAAGGAGTCCCAATCGACG
ACTCACCGAAACCGGTCGAGCCTCTCTACGCTGTCACGGTGCATGAGGCTGGAGCTGAAGAGGTGGAGGCAGCTCGACTTTTGTCGCCGAGAACTGATGA
GTCCAACTTTTATGCGCCACCGCGCACCGTGGTGGGGAGGGAGAAGGGCATTTATTTGGCTCCTGTCGTGGTGAACAAGCGGGTCACAGCAGGTGACTGG
GAGCAGGATGTGAGGCACTTGGAGTTTGATATTCACAGTGACTCGAGTGGTGGGGGAGGGGCTGGGGCCCCGTTCAGAGCTGGTGATATTGCGGTGATAT
ACCCTGAGAACGTCACGGGAGTGGACAAGATGCTCAAGTATACAAACATGGATGGAGAGACGGTCATCTCGATTAACGCTGCTGATGGCTCGAAGCAGTT
CGACCTGCCATCCCCGATCACTGTCCGTGATGTGTTCGCAAAGTACTTGGCGATCCTGGAGATCCCGCGCCGGAGTTTCTTCGAGAGGCTGTCTCTGTTT
GCTACAAATGAAGAGGAGGTAAGGCATCTCGTTTACCCCGCATAGCGTGTGCTTGAAGATTCTAACTTTGTGTAAATCTGGGTGATGCAGAAAGAAAAGC
TCGAGGAGCTGGCCTCAGCCGATGGTGTAGATCTGCTCTATGACTACTGTATTCGTGAGAAGAAGACGTACGCCGAAGTGCTAACGGACTTCCCGAGCGT
GAACGTGCCTTTGACGATCCTGTTGCAGCTCATCCCTCGTCAGCAACCCCGTTCGTACTCCATTTCATCGTCGGCTCTGCTCCACCCTGGACGCGTAAGT
TGTTCGATAGGATTCCTTCGATCATCGTTTGCGTCATACTTATCGGGTGTCCATTTTGTAATGTTATACTAGGTGCACTTGACGGTGGCCATCGTCGACT
TCCTGACACCGTACAAGCGCCGCCGTAGCGGAATTTGCTCATCATTCTTCCAGTCGCTGGATCCGTCGAAGGAGCAAAAACTTGTGCCAATGTGGATCAA
GAGGGGTCTCTTTGAACCCCCCAGCTTAGAGCGCGATGTGCTTCTCATCGGCCCGGGGACAGGACTCGCTAGCATGCGCGCGATTGTGCAGGAGCGCCAA
TTCCTGCGTAAGCAAACTGTTGCCAGTACTGGCTCCGGGTCAACCTTCCTCTACTTCGGGTGCCGTCATGAACACAAGGTGAGAACGCGACTTCGTGTGC
TAAAAGTCCCTCACCCATTTAACGAATCGATTGTTGCGATGTAGGACTTCCTTTACGGAGACGAGCTGCGTGGGCTTGTGACTTCGGGTGATCTCACCGA
GCTACACACCGCATTCTCTCGTGATCAGGTGCTCACTACCGTTCAACTATTCTCGTAAACCCGGAAAGCTGATCAAACTAATCGTATCTCCGTCGTACTT
GCAGGACCATAAAATCTACGTGCAGACACGACTGGCCGAGAACAAGGATGCCATCTTCGACTTCATCATGAACGGCGAGGGATGCATCTACATTGCTGGA
TCCGCGAAACGAATGCCGAACGACGTGTACGAAGTACTGCGTGACATCGTTCGCTCAGTCGGGAAGATCCCCCTGCCAACCGCCGAGAAGGTGATGAAGA
CGTTGGCTCGCAAGAAGCGCTACGTCGTCGAATCTTGGTCGTAGAAACCTCATGCAGGCTAGATCAAACCAATTCAGTAGACTGCTTGGCCATCTCGGTG
CACTTCACCTTTTATGATTCGCTAAAAACACACAGACCATGTCCATGGACACCGCGCAGGAACTGGAGCAGGCGCAGCATGTGCGCACGTTCGTGAGGCT
CGCCAACCTCACGCAGACGCCTGAGCTGCACGAGTGGAACCTCGAATCCCTTCAGAGAGCTCTGCAGTGGGCTCAAGTAGCGGAAGATGTGGTGGATGGC
AGGGAGGGCATCGAATCGCACATCCGTCGGTGGTTCCCCGTGGCGACGCTGCCGACGCTGCCTTTGGATGGGGCTCTGACAGCCGACGCTCTACGCCATG
CAAGCGTCCACTTGCTGCAGTCCATTCTGCAGAGCCCGTACATGGCGACGCATCCGACGCGGTCGGAACTGCTGGTGGCTGTGCTCCAGGAGCTCCAAAG
CAGACACGAAGACTCGTCGGCTGACGAGCTGGAAGAGCACTCTAACAGGTGACTTTGCTAGTGGCGCGGTGTGAGTGAGAGATCCTTATTTTGTTTTTTG
ATGTGCTGGTAGTACGTTGCTAACGGAGAGGGTTACTGGAGCCCCACGCGCAGACTCGATGCTAGCCATTGCTCGTCGAATGAGTGAGGCTTGCAAGCGC
ATTCGTGTGCAAGGTAATTGTCTCTGTCGCAATGTGGTGCAATGAGTGATACTGACGCGTTCGTGCAAATGAAGTGCTTTCTGGCTGGATCCTGGTGCCT
CCACTAAAGAGTTACGCACTATCACCACGCACGCTTCAGCTAAAGGCTATGGCGAAAACGTTGCAACGAAATGCAGTGGATGCTCGTGCGGCTGCCAACC
CCGAAACGTACCGAAAATTTCTCAATGACCTGCAAAGCTGTTTTGAAGTACTTGAAAGTAAAGATGTCCGGGTAAGCTTGCATGATGACTCTTTTTGTTG
GTGAAATGATTCTTATCAAAGAAATGATGTCATTTGCAGGAAGTTGTGGTGTTGATGCTGGTTATGTGCGAGTGGCCTGCGCAGGAACCTCCACAACTCC
GAGGAATGATGGAGGATCTTATGAAAATCGTGCGTGACTGGGTAATGTACAAGCCCATTCGGTACTGGACGTTCTCGCCGTGGTTGGCATCCATGCTGGC
GAACAAATCAGAAGCTCTCGCTCGTGCGTATGTAGTCGAGTTGTTCACGACAGGCCTTTTGCAACCATGTGAGATTGCAATTCATTGTCTGCACCAGTGA
GTCATCTATTGACTGTACATGTATTTTCTTACGCACTTTGCATTTACTTTAGGGGAGCGCGAGTTTGCAGAGCGTGTTGCGACGCTGGTTTTGCAGGGTG
AAGGTGTGCAAGTCGTACTTGAACCAGCTTTGGCAAAGTTGGATCCCCATTTGCAGCAAACCTACTTCAAGGTAAATGCAAGCAAGTAGTTGCGACGGAA
TTATCTCTTAGTTCCATGCCGACGCAGAACATCGACGACATCGTGATGATTATTGCGGAGTGCTAGGTCGGTTGCAGTGGGGTAAGGCACTTGTAGGAGT
GGCAATGCAGTATCCGCGCCCTCGCCAATCAGTGCAGCACAGCAGTCTGCGAATCCTTCTTCTCCAGCGATCAGCACTGCAGTATATCCGAAGCGATTAC
GTTGGTTGATCAGTGACCGAGTCCATACTTCGTCGAGGTATGACGATTGGCGAAGGTGGCGCAGTATCAGCTGCAGGGAAATTAGCGCGTTGGATGCAGT
TGCAATATGTAGAACTGAATTCCCATCGGCATCCGTCACAAGAACTCCTGCTCCATGGCTAGCGTATATTGATAGCTCTAGTTAGTAAATCTGTCCGAGA
CAAGTTCATCGTACGAACACTTACTGAAGAAGGTAGCTGGCAACATCGTGTGCATCCCAAGCGCATGCATACTGCAGAGCTGTGCGACCCGTGTGAGGAT
GCCGTTCGTCCAGCAGTGTCGGATTGTCGGTATAAAGAATGGCAAGAGCACAAACATCGTTGTCTCCAACGGCTTCCATCCACTGGTCCAGGAGCTCCAT
CTGATCAGTCGCGTGAAAATAATGATCAATTTATTAGGAAGGCACTACATAGTGCATGGCCCGGCATATTTGGTCGATACAACATCAGTCAGTGGTGAAG
CCGTACACCTCGGTCTCCAGCACCGCGTACAGCACAGCCTTCAACTCGTCGCGAACAACGTGCAGTGGCAGGTCCAAACGATTGAAACAAGCGTGGCTGT
GAATGAACCCGTCACCAATCAGCGACACGGCCTTCAGTGTAAACGGGCACAGACGACCATCGTAGCTCGTCAACGCACTGAACCCTCCGAGAGGAACGCG
CGATGAACCAGTTGAAAACTGCAGCAGCCGACGACGATACTCATTTGGCATCTCTCGCACTAGCTCCCAGAACCACTTGAGTGAGCGGTGGTGGTGAAGG
TCTTCCGAATACTTTGTGTTGCGCTCCCAGTCATCTACGTCGATCTCGTCGGAGCCGCACAGCAGGAAGTCGAACTCTTCCGGGTCGAATAGCAGGAGAA
GTTCGCGAGGGACGATTTCGTACAGGCCCTGCAAGAAGACTTGCAGTTGAGGGGCCACACTTTCCACAAGCAGGTATTGCCACTTGAGCTCCACGAACTC
GCGCTTGTTGGAATCGGTGACGGGAATGGCACTGCCGCCAGGCACGAGCTCGATATCGCGATAGCTATCTCCATCCTTGGTAGTCACGGTGAAATCGAGA
TCTAGCGCATCGACATTGTCGTTCTCCAGTAACCAACGCAAATTGCTGTACACCTCTGGGTCCAAGTCCTCCAAATCTTCAAAACTTAACGGGTAGCCCA
GGATCAGCTTCAAAAACGGCGAGGCCAAGTGGAAGCACAGCATAGAGCCCTCCAGGAGTGCACGTCCCAAGAGACGACCAGCCGCGAAGAGATTTAGCAG
CTGGTTAGGAAGTAGTTCCATATCCGAGCAGGGGCTCATGTAGTATGTCTGATCACGCTTGTTAGCACAAACAAAGAGCCCACGTACTGGATCCACAAGC
GCCTCATTGAGCATCACAAACCACTCACGTTGAAGACCCCCAGCGTCCACACCGTTCTCATCGAGGAAGTTTATGCGCACTACAGAACGAGCATTCTGGA
GCGGGATGATAGCGAGGGACTCCATCGAGTCTTTGAACACGCTGGCACGCTCAACGTTGAGCCGTAGATGCTCTCTTTCAGCTGGAACCAGTAGGGCTGA
AGCAGCCATGACGAAATGTGCATACTTGGAGGGAAAATCTTTACTAGCGAGCGCCATTGCCAGGGGTGGTGGTGATGCATTGCCTAGGACAGTATCGGTT
CCCAATGCTGTACGAATTGGACTGTTCGGCAGAGTGAGAGGAAGTCTTGTGGCATCCATATCAGCGTCAGCTGCTGATGTGAACACAGAGTGCATCTCCT
GTGCGTAGTTTACCAAGCTTGCAGCGCACTCCGCAACCGATCTGACCATAGGTCTTGGCGACATTGCTCGATTTGCCGCATATTCTTTGTTTCCCTCGGT
GTGTTCTAGTTCGGGATCTGGTTCTGAGCTACTCCGGCTCGTTGAAGCATGAGCTTCAGGTGATTTTCCGTCCACGGCAATTCGACTGTTTGCAGGCTTG
AACTCAACAACAAAGCCTGTTGCAGGTGTATCAGCCCCAACATTGTGGCTGTCACGAAACCAATATGGGCGTCCTTCGACATCAAGTTTGCGTGTCCACT
CCTTGCGTCTCTGTGCCCGTACACGGCGGCGAGTGGCTTGCTTCGAGGATATCGAAAGTGCAGTGGACGAGGTCGTCTGCGTTCCCGTATGTCGCTTGAA
AGTCGACAACATTCTCGTCAACCTTCTCCTCTCGCCCTTGTTGCGCGACGGCGAGCGGCACGAGAAAGGTGCCTTCTCCACAATCGGCTCGCCACAAAGC
GTGCAAAAGCGGACACGCTTGAAGTTCTCAAACGCACAGAAGTCGCACACGATGAACCCTTCCTCCGCATCTCTTCACACACAATATAGCGTCAGCTCTG
CCAGCCTCCCTTTAATTGAACGGAGACAAACCTTAGTGCCGCATCCAGACGTCGATCATCGGAGCTGCACCCAACCAAATGGACAGCAGATAGCCGTTAG
ATACAGCAACCACACGCAGAATACCCGGACGAAAGCAGATAGCCTCTAGCCTCCGTTATGGTCAACTGCATGTGCACGTACTCGATGAGTGGCGTATTCA
GCTCCACCTCGCGCTCGAACTTCTTGAACGAACGTCGTGCCAGCCACGCGAAGAAGAGTGCGAAGAGCAGGGCGATCCCACACGCCACACCGATGGTCAC
GCCCACAGACATCACTCGGTGGCGTCCTTGAGAAGGGCGAGAAGTTGGAGAGTGTCAGTGACACTGTGTCACGCTGGAACAGGTGCATTGCACACTTCGA
TCAGATGCCGATCAAAATTATGATGAAACACAGAAGTGTTCACCTTACACAGTGAATTAGTGGGGTACAAATTGATTTGTGGTTTTACAGTAGAAGGTAT
CGAATCAAAGTTTTCAGACCGCGTCAGTTTGCGGTTGTGGCTGTTGTGTACAGTGACAGAAATCTCCAAAGCAAAATGCACTGGCGAAAAGGTCCCTTAC
GTGTAGCCAACGCACTATTTAACCGGTTGAAGCACGCGTGACTGTCGATGTACTTATCGCCCTCTCAGCGAAAATGCACACAGCCATCTATCGTAGTGCA
CCGCAGCCACCGAGCGGTATCCACAGGACGAACCCATTGAAAACTGCAGCAATCGGCGTCATACTCGTTGGGTATTCCACGCGCCAGCTCACAGAGCAGC
GACGTGGTGCAACAAGTTCGAGTAGTCGTTCACGTCGAGCCACACAGCGGAAGTCAAATTCTTCCGGGTCCAAGCAAGTCGCGAGGAATGATTTCGTACA
TTCCACGAAGAAGACGTGACGCTTCCTCGAGTAAGTACTGCCACTTGCGCTCCATGTATTGTTGGACTTCGGGACGAGCTGGTCTCCTTTGTATCTACGT
TCTCCAGCCGCCGACACAAATTGCGATAAACCTCGGGGTCGTAAGTCTTCCTGATCGGCAAAGCTGAGGGGGTAGCCCAAAACCAGCTTCAGTACAGGCG
ATTCTAAGTGAAAGTACAGCATCGAG