Description :
From Genome Similarity Track
Location :
Scaffold_7:270355- 279314
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05073polysaccharide lyase
Phypa_INRA-310PPTG_05074polysaccharide lyase
Phypa_INRA-310PPTG_05075hypothetical protein

Sequence
8959 bases(100 bases per row)
TGTCGGCGTTTAGGAAGCCACCAGGAGTGCCATCCCATTCGCCAATGCGCCAAATCGGATTCGAAGTCATGTTGTATGAGACCGTAATGCTTTGAGTCTT
CGTCGCTCCTGCGTTGATAAGGACAGATGCCGTACCAACTGCTAGCTGCTTCTTGTACACCGTTGCCGTGTAGCGACCAGCCTTCATCAGCGGCGATGTG
AAGGTCTTCTTCCCGGCAGCTACTTTCACCCAGTACTGAGCAGCAGCGTTAGAAAATCCAACGACGACGTCCGAGTTGCCCAGTACGTTTTTAGAGTCGG
TGATCGTACCCGCCATTTTACCTCGCTTCGCGGAAGGAACAAACCCAGTGAGACCTAGATCTTGGAAGAAGTTGAAGTCAAGCGACGAAGCTGATGGTGC
AGCACCACTTGTGAAAGTAAGGGCGTACGGCCCGTGGAAACCGTAGCGGTAATCCTCCGTCCTCGTGTGGTCCGAGTTCATGTAGAAGGTCAGCTCGTTG
GAGACGTCGAGCTTGTTATTGATGTCGCGGAAGAATGGACCACCGCTGGACGTCTCGTAACCGACATCCGAGATCACGAAATACGCGCCCACGGACTTGC
CCTTCACACCGTAGACAGCGTTATCAATAAACGGCACACCCGAGTAGTATTTGGAGCGCGTCAGACCTTGGCTATTCTGCATGACGTCTTCTGCTTCAAT
AGCGGTCATACCCGACTCAATGGTGGCTTCCGTGATACCAGTGTTGACGGCCGACTTGTCCAGACGCGCGAGGAACCGGAGCTCTGGCAGCACGAGGTCT
TTTGCGTGATAAGTGCCCATGTAGATGACGTTTTCGTTGGGACGGAAGAGGTATGTCTGTTCCAGACCGGTTTTCTTGCAGATGACGCGGATGGTCTTCT
TCGAGTCACTCAAAGTCTTGATGGACGACGTGACCTTACCAAGACCAGAGTTCACGTGAGTAGCCTTGGACTTGTACTGTAGTTCCTTGCCGTTGTAGTT
GATAGACGTGATATCACACGTGGATTGCTTCATGGTGACGGTCAGACCCTTTCCGGTGCTGACAACGTACTTGTCGGAGCCCGTGGAGTATCCGAAACTC
GCGGCTGCAGAGACCGTCGGAGGTGCTGCTGTTAGGACGGTAGAAACCACCAGAGCGAAGGCAAATAGACGGCAAAGCATTGTGCTTGAAGGAGATGTCG
CTGGGCTTAACTATTGCGCAGAAAGTTGCCGAGTGAGCTCTCTGATCGAGCAGAGGATGGAGCAGAGAGGGGTGGGGAGACGACGTCGTTGCTGATCATG
CGGTGTTCATGAATGACCTGCGGCAGTTGACATTCCAGCAGTTCGAGAAGTAGACCTCATGTCTTGCTTTTATTGAACCTCAGTCACCGTACAATGCTCC
GTCAATACCGCAAAGTTCAAATAACTGCTCAAATCCAGGCATGTTACTCCATCTGGAGGGTACATTTTTTCAGCTGCTATCACAACTCGATCCTAGTGCT
GTTAATGTAAACCCGAAATGTGGAAGCGTGCGTCCGTGAAGCTATCGTTGCATTTCGATAAGTAGAAGGATTAACGAGTTAATTACAATTACATGTACTT
ATTATTATCCAGAGTGGCATTGAAATTGGTATCCCGAGTTGTCCGTGAAGTGTCCGCCAACCTTTACATTGCCTACTAGCGAACAGCTACAACCTGACGT
CGAGCACGACTGGTTCGGCTTTCGAAGCGACCTAGATGATCATATTGTTGTTACAGACACTCTGCTTTCAGGATTTCAAGACCTGTTCAACTTCTAAGAC
CCACTTCAAATGGTGGAGGTAAATAAAACTTAGAAAAATACTATTTTAATACAAATACTTAATACATACCGGTGTATCGTAGTTCGACACAATGCTTCAT
TTTGTAAAATGGATTTCTAAAAAACTATAAAAAAATTATCTGTAACTGGAGAAGAAAAAGAAAAACGAGTGTGTACCAAGTCAAGTAAAAATTCAGGTGA
ATTTTATGAACTTCGGATGCTACATGTAGAGCTTGCGTTTGTTCTACCATGTACTGACGTAAGGCAATGTGTTCTTAGACCAACTCGAGAGCGTCGAACA
CTACCGATGCCGACAACCATTTTCCAAGTAGGTCCTTGTTGCCGCTCACAATCGAAAGCTTTATCTGGTTGGTTCCCTCGACCAAAGCAGTCTTGGGAAT
GGCGTAGTCGTAGAACATGTACTTGCCCAGGGTCACACCACGCGTGACACCGCGTGTCTTCACAGCAGCGCTCAGAGGAACCTTAGCCTCAAATTTGGTG
TTCACAGTCACGCTGCATCGACCATTGTTTTGGGCGAGAGGAATACCGACCTTCAAAGTGCGATCCGCGCCGATCTGGTCCTTTGTCAACTCAAAGTTGA
TCGTGATCGGGTCGTTCACAGCACGGAACATCGCCATTGGGAAAATCTCGTCCTTGTCCGTGCCGATAGTAAAGTTCAGCGGTTTCCAGGGCTTCATGCG
GGAGTCACTGGGGTGCGAGGTGTGGATCTTGTCGGCATTCAAGAACCCGGCGGGAGTACCATCCCACTCACCAATGCGCCAGAGCGGCTTGGCCACGGGT
TCATACGTGACCGTGAGGGTCTTCGCACCCTCCACGCTCTGAGTTCTGCGTCCTCCGTTCGTGGCCGGTGCCGGAGCAGCCGCCTCGGTGCTTGCTGGAG
CTGGAGCCGGAGCCGAACCAGCAGCAATCGTGATCGTTTCCGAGCTGACGGGAAGCTGGTTCTTGTAGATGGTGGTGTTGTAGGTTCCAGGGACCATCTT
AGGCGACGTGAATGGCTTCGAGGGGGAGTCCACCTTCACCCAGTACTGGGCGTCGGGGTTGGAAAAGCCAACCACGACACTAGAATTACTCAGCACGCCA
TTCTTGTCGGTAATAGTACCGGTCCAGGAGCCACGCTTCGTTTCCGGTACGAAACCTGTGAGGTTGAGATCTTGGAAGAAGTCAAAGTCGACATCGGTGA
CGGCAGGCTGCTTCCCGTCATTGAAAATTAGAGCATAGGGTCCATGGAAACCATAGCGATAGTCTTCAAAGCGCGTATGGTCCGAGAACATGCATAAGGT
AAGTTCGTTGGCCTCCGTGCACTGGTTGTTCATATCGCGGAAGAATGGTCCACCCACTGACCTTTCGTAAGCGTAGTCGGACATAATGAAGAACACACCG
CCAGCGTCACCCGTCACGCCGTGAACCTTGTCGTCAATAAACGGAATACCGGAGTAGAATTTCGAAGCCGTGATACCTTTCGAGTCTGCGAAAACGTCGT
GGCCTTCGATGGCAGTCATGTTATCGATTTTGCACTCAGGAACCATGGGGTTGTCCATCGGTTTACGGGCCAAACGAGCAATGAAACGGAGGTTTCCCAT
TTCATACTCCTTGGTGTGGTACGTGCCCATGTAAATTACATTTTCGTTCGGACGGAAGAGGTACGTGTGCTCAAGGCCCGGGGTCTTGCAGGAGATCTGG
ATCGTCTTGTCCTTGAGAGACTCGATGGAGGTGTTGATCTTACCAAGACCGGAGTTGATGTGCGACTTCCTCTGCCAGGTCTGCAACTCGGCCTTGTTCC
AGATCATGGACGCGATATCGCACGTGCCCTGATCCACCTTGACGGTGAGACCGGCGCCCGAGTCGATCACCCACGATGCACCATCCTCCTTGTAGCCGAA
ACTCGTGGTCGCCGCTCGCTCCTCTGCAGAGTCGAAGTTCAGGTTCGATGTCGCATGGTTAGTGTCCGCTTGCGCTACTGCCAGCAGCCCACTCGTCAGC
AGCAAGGTCGAACGGAATAGTCTTCCTGAGAGCATCGTCTTGAAAGCCTCTTTCCTCAAGGTGGGAAGATGTGAAATGCCATGGCTAACCAGGACCTGAA
CACCTCTGACAGGAAAGAGTAGCCTGGAGACCGCAGAGAGGCAGTCAGGCTGAAGTTCGCGACTCGCAGAACATCCGCATACAATCCGCAATCGAAGAGC
TCAAAACGAGCTTTGCTCGCCGTATGTTGCGTTAAGGTGCCCTGACTCAGCACCATTCTGCCAAACCTTATGTCGTGTTACTAACCTAGAAAGGGGACCA
AACAGCAAAATAAACGTTCTCTGGATATTTATATCCAGAGTCCAGAGTTTTCCAGAGTTTTAGGGGCGATCGGAAAACGTCGACGATCCTGTCAAATAAC
ATTTGTACGGTCAGATCTGTAATTATCAAAACCTTTGGTGCGAACATTTCTATCTAGATATGACGCAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGAAACCAACTGTATGGATGTGTCGA
AATAAAACTCAGCAGTGAACCCAGCTTATCATGAAAAAAGCTCACTATACACATAATTATATCCTCCCCACTATCCGTCTCATGTTGCATCCGACGCCTA
GCCGTCTCTATATCTCCTGCTCCGCCGCAGCATTAAGCTAAACAAACCAAGAACGATCTGATTTTCTGGTTTGTTTTTCGCCGAATATTAAAAAAACGAT
TTAAAAATTAAGAGAATCTCAGCCTGAGTTCTCTTGCGCACTTTTGCAGGTTGACGAGTACTTGTAGGCTTCGTAGGGCGGTGCTGATTGGAGGACAGCG
AGGGCAGACACTCGAAGGTAAGACAGTTGTGCTCGAGGAGGCGGATTCGGAAGTGAGCACTGCTTTGGTGCTTTCATCTCCAAGTTGAATCCATGTATTA
GTGAATCAATATCTAACTACTGTCCACACTACCTTTGCTGTTCTCAGGTTCGACAATCCAGTCGGAACTCAGCAATCGTGGACGCTCTCCCGCAGTTAGC
ACTCGACTCTCGAGATATACAAGATATACAGCTTTGTGGAGCATTCCTCCACAAAGCACATGCAGCAGTCATCCACAGATCCAGGCACCGTACGTCCGCG
TAACCGTAGCCGCAAGCAGTCGACGTGACCACATTCTGAGATCCCAGCAATCCAGCGCCTCGCGTCATCATCCATGCTTCGAGCCATCCAGTTTCTCACG
GTGCTGGAAACCTGCTGGATCTCTCATAAAAATGAACTTGTGATGTTTCCCACTAAACACCGTTTTTACCTTTGCACTTCTTACTTTTTAGCCACTGGGG
TGGTGATTTGGAATGGTCGAATAAACGAGAAGAAATTAATCCAGTTTAAAGACTTTGCTGCTTTTGCCTTGCCATGCACTCCATCATAGACAACGCGGCG
CTTTCCGTTTATCTTCTGTACTAACTTATGCAATTTGTGCACACTGCAAGAACACTAACGTGGTCCATATAATAATACGTAAGAACAAGGGAGCAGCTAC
AATAAATAAAATCTAGCCACATGACTACCGGTATTGAATATCCGCTTGTACCACATACCTACTAGAAAACCGGTATTTTGAAGCTGGTGTAAAACCTGTG
TAATGCCTTGGTGCCTATTATTAGCTCGATACCATAACTGCTCACTTTGTGCTTGTAAACCTGACTTAGTTTTGTATTGCTGACTTGGCTTTTATATGAA
AACCGGTACAAATACATCCAATCCACACTGCGAATTAAGTATCCAAATATCCAGAGCTTCCCGCAGCACGGCATTAGTTGTGATCGTAACGTGTATTGAT
GAATATTGCATCTCTCGACATCCTTCATGGCCCGATGAACTTAATCTTAATCTGGCAATTCACGGTGCGAGTTAGCGTACCTGTTGCCACTGAGATCGGG
ACATTGATTAGTTGGGTGGTGCTGCAGTTTGCATTAACATGATCGCAAAGCTGCGTCTCCCCTTGGACGATCACCTTGTCACTCCTGTCGACGAAGATTT
CAGTTAGTAGACATGGCAAAATAGTCGTTACAACATAATACGAACCTGAAGCAACAAGTGAAGCTACGCGCCTTTTTCACGCGAATCACCAGCGTGCAGT
CACGGAGCATCTTAATATGAGAGTCCACAAAGTTCAACTTCACTGCCGTCGACTCCCACGATGTACCAATTTCCGTACAAGCTGTTTTGCTGGTGCTTCC
ATTACCAACGACCTTGAGATCACGCAGAAGCTCCCATGCACAGTACATCTTCGTTAAGGGCTTCCACGTCCCTTCCGCGCCAATGATTCTAAGTGAAATT
GACGGCTCAGGAGATGATGTAGTAGCCAGAATGGGAATGACTGGTGGGCCGGACTCTGGATCACATAGCGTGACGCAATGTTTCAAGTCGGAGTATTCGT
CATCACTTAACCAGATGTAGTAGCCCTCTTTTGTGGCACCACGCTGCAATTGGCAGGCTCTTCCGATAGTATCCTCGTTGAAAGATGGATCATGGAGTGC
CAACAACTGCAGTAGAAACGCCCTTCGTTCTGCCGGGCCCATACCCAACTCATGTGATGACTTCTCTTCGCCTGCACCTAGATTTGCTCTGTCAAGAACC
TCTTTAGCCGTGATCTTTTGGTTTAATGCCGATTTCGACGCTTGGAATATACAATATACGAGAATATCAGCAAATACTTCGAAGCACCTAGCTTTCAACG
CAAGCAAACTACCGTACCTTCTAAAACTTGATTCACGGCGGCAACAGCCACGGCATTGGGGATGGCTACAGAGGCTGCTGACAGGGCAGAAATACAAAAC
TATAGAGCGTAAGTCAGTTAGGCAAGCCCCTTGTCTAGATTAAGTTAACCAATGTCACGTGAGAGAAAACTTACCTGAAACATCTTGGGATAGCGTGTCA
AGATGTTGTCGTTAACTGGGATCTGCAAGGCTTTATGCTCACACTTACCCGAAACATCACTGTGGATCCGTAACTCGACATGTGATCCCTTTCTAGGATA
CAACAACGTCCATAGACGAGGTAAACGGCAACTCTCGCTAGTGACGACAATATTTTTCACCGCTTCCAGTTGATGGCGTAACTGGTGTATTTCATATACT
CCTCCGTTTTTCCACGCGCACTGGGTAAACCAGCCGAAATCAGGCGGTAGCCATCGCGCTTTAGCCCGCTGTCGTTTTCCGTCCTCGGGATTTTCCATTA
AATCGTTTACACCGCGGTCCTCTCCATCGTCAACAATGAACCGCTTGACTCTGGCGTGCTTGGTTAATCCGGGGTAGTCTTTTTCCAAGATTTTTTCCAT
ATCGGTCACGAAATACATCATTTCTGCCCACGCCAACTTCTCTGTAGGTGCCGCTACTTCAATTAAGATATCATTGTACTGCCCCGTTTTATTTGCACTG
TGGTTGACGACGGCGCGAAACTCCCTGCGAACGGAGCTCTCGAAGTATGCGCGTCGAGCGCTACGATGGACGAACGGGCGATAACACTTCACCACAAAAT
TCACGAAGATAGCGTCGGATACAACAATGGGTAACCAGTACCGCCACGTTGCCACATGCCAACTATCGCCAAAATCCTGTGTCAGAATCGTCTTTTGCGT
TGCCAATAACTTCAAATCTGCTTTGGGGGTTTCTCGCGTCTTCCAGTACATCGGAACTAGTATATCAGCCTTGTCAATAGCCTCCATGTCGTTGACCGGG
TATACCAAATTTAAGCGATGCAGTAACTGCTTGAATAGATGGACCATCTTGTCTTCAAC