Description :
From Genome Similarity Track
Location :
Scaffold_8:270312- 275480
Transcript NameFunction/comments
Hyaar_Emoy2801619gag protein

Sequence
5168 bases(100 bases per row)
CTTCCTCTGACTTAAGGAGCTGTGCAGCTCCGCTACACTTGGTAGCACTTGTAGTCAATCTACGCCCGAGTCTTTAAAGACTGATCCTCTGTGAGGATGA
AAACCCCCACTTCCCTCTCTGAGGCCCAAAAGGTCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTGGGATTCCTTGTATCGCAAGGCCT
GGAGGTTCTTACTGCACGTGTTGAGAGGTTCTTGCAGTATGAAGCGTCTCTTCTCGGGCAGGTCCAAGACCAAATGGCGTCGGCTATGCCTAAACGCTAT
GTATATGTTCCAGACGAAGAGGCTAGGCCTCGTCCACTTAGAGTGGAAAGCTAAAACTACTCAGGAAAGGAGGGTGAAAACCTCATCCTCTGGATCCGTG
AGACTGAGATGGCCATGAGATCAGGCCTGGTCAAGCTTGACCATCAACAGGTCTCGCTGGCTATCTCAAAGCTAGATGGAAGAGCTAGAGAATGGGCCTT
GACGTGTAGCACGTCGGTCGACTTAGCGTTTCCCACATGGGATTCGCTTAAGTCACAATTGGTACAGGTGTTTTCACCACCTAACCAGGCTTACCGCGTG
CGTTCACGCTTTTTATCAACGTGTCAGGGTAAGAATGAGTTAACAGACTATGTCCAAGAGCTTAGAACTCTCATGGTTGCTATGCAGTATGACCCTCTGC
CTGAGGCAGTCCATGTGACTATATTCATGGAGGGTCTCCGTACTGGCGTTGCCAGAACCGAAGTCTTTCGGGTTCACCCCTCTACATTCGAAGAGGCTGT
TAGAATTGCTCTTAATGCTGAGCATAACTTCAAGTCGGCTAGACTTGGCTGGAATGGGTACAATCCCGGCTCTGCGAGAGCAAACTACACGAGTACTCCG
GACGTTAATAGGCCGGAACCGATGGATCTCAGCTATGCTGAAGACGATGGTGAAGTTTAACTTCAAACTGCTGAGCAGCAACGTGTTGTACGACGGCGTT
ATACGTGCGGAAGCACTAAACACTTACGGCCTGGTAGCTCTTTACGTAGACAGCGTCAGGCTACGAGCCAACACTGTACCCCGAGCCAGAAGTCTGGCAT
GGCACGGAGAAATGTCGACACCCAGTAGGCGTGGGGCGTCCTACTAGGGAAGAACTAGGTTCTGTAACACCTTTAGGGGGTAGATTTGAACAGGGCTTAG
CCCCAAAGAGTTCCATACCTACTGGTATGGAGCGTGGGTACAAGGCTGGCTTGTTGGTCCCTGAGGCGAAAGTTAAAGGCTTTGAAAAGCCTTGGTCGAT
TTTAATCGATTCTGAGGCGTCTTTCAATTATGCTCGACGTCGTTCCCTTGAGGGAAGTCAGCGTTATGCTGAAGCGCTTACATCGCATGAGGGTGATTCA
ATCACGGTTCGTTTAGCGACTGGAAGTCGTGTCACTGTACCTAAAGTTCCTTTAAACTTGGGTATAAAGTTTTTGGACTTTGATAGCATTGAACGCTGTC
TTGTCCTTGATCTGGACTCGAGATATGATCTCATCCTAGGTATGGCTTGGCTTGAACACTATAAGCCATGGATTGATTGGAGGTCGAAGACCTCAGGCGC
TACGCGCAATGTTCCTAGCGAAGTTTTGGAGAGTTATGAACTCACCTTTGCTAGGCAACAAAAGCACTATTGGCGCGAGCCTTTGATAGAAAATGTCAAT
GTGCTGGACATTGGAATGTCTGAGTTAACTAAATCCAATGTTGAAAACATGAATTCTGGGCGTAGCTCCTTGAGTATTAGTGATACGGCACTTACTCCGT
TGAGTGTTACTCGTTGTGATAACGAGCCACTGAATGCTGAAAGAATGGTTGGCCTAGGGCCGAGTTATCAACGATGTGATTCCTTTGATGTGTGTGGGGT
GACACGTGAAAATTTACCGAGTGCGGTCGGCTGTGAAGGCACCACACTTGATGTCGGTAATGATATCAGCTCTCGTATAGAGCGTACCACTACTAGTAGT
AACCACGGGGACACTAATGTCGCGACCCCAGAGGGGTGTAAGGTCTCATCGAAGAGACGACCGACACGCCAGGTGGCAACTGTTAAGCGCCAGGCGTCCG
TGCAGTCACATAGTGACAATAGTGATACACTATACACACTTGTCAACGGAGTGACTGGCCAGGTGGAGGGCAATGTTAGCCTGGAAACCCTTCCATCTTT
GGATGCTCTTTGTGAGCTAGACGACATGTCTGATGGCGAATTTAGCCAGGCCTTTAAGACAGGAGATTTATCCGAATTAGTGGTCATTAGACCCGATATT
GAGTTGAACTCGTCCTCATTAATGGATAAGTCGGTCCTAGAGGACACCAAGGCGGCACTCAGTGCCCGGAGTGGATCTTCAATCCTTAAAGATCCTTTGG
ATCCATTCTATCCTTTGGTCAAGGAATTTAAAGATGTGGTGTGTCACAACCCACCATCTATCTTATCTCCCGATAGAGGTGTACGTCATGAAATTGACCT
AGTTCCAGGAACTAAATACTGCGTAACACGGCAGTGGCCTTTACCTAAGGAGCAGTGTGACGTCATTGACGATTTCTTTCGTGCTAAGCACGTGGAGGGA
ATGGTGCGGGAGAGTAAGTCTCCCCATTCCACACCTACATTTTGTGTCAAAAAGCCTAATGGCAAGTGGCGTATTGTGCACGCTTATAATAAGCTCAATG
CTGCCACTATCCCGGTTCAGACACCAATCCCCAGAAAGGATGTTCCTCAGAAAAATATGGCGGGATGTACATTGTACAGTGCGCTCGACTTAGTCAATGG
TTATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAGTACCCCGAGCGGTATGCTCTAGGAGTGGCTCGTTATGCCATAAGGGCTT
TCAAATGCCCCGGCTACTTTTAATCGTCTGGTGACGCAACTATTCAGACCTCACCGAGGCTAGCACAAACGTACTTTGATTACATCTTTTCCATAGTCGT
GCAAACGAACGGTCGATCTGATGTGGATAATCATATTGATCATTTACGAGCAGTGCTCGAGTGAATGTGCACGAATAAATTGTATGCAAATGCGTCTAAG
TGCATCTTTGGTGCAGAAGAGATTCCCTTTCTGGGGTGCTTCATTGGAAAGCGAGGCCTTCGAGCGGACCCCGCTAAGATAAGGGCCATAGTCGATTGGC
CGGTTCCAAAGAACCAAAAGATTTACGCAAGTGGCTTGACCTTGCCAATTACTTGCATAATTATAGTGAGAATTACGCAGATATGGCTCGGCCATTTTCC
AATCTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTATAACACCGAACATGATGCTTTGCAAGCAGTTAAGGAAAGTCTCCTTCATGCCAATACTGGCTT
TGCCCGATCCTGATCGGCCTTTCAGTGTCGTCTGTGACGCATCTAAATTTGCCATAGGCAGTGCTCTGTTACAAACAGATGTCGATGGACGCGAACGCGC
CATTGCATTCGAATCTCGACAGCTCAAAGCTGCTGAAAAGAGCTATCCAGTTCATGACAAAGAGCTACTTGCTATGAAGTACGTTCTAGTCAAATTCAGA
GTACATCTGCTTGGCTCAAAGCCATTTTTGATCTATACAGATCATGCGTCATTGCGCACTGCGACACAGTCGCCGCATCTCTCTCAGAGAATGGCTCGTT
GGATTTCATTCTTTGCCGAATATAACTTCGAAGTGAAGTATAAGCCAGGAAAGCAAAATGCTTTGGCTGACGCGCTATCGCGCCGACCTGACTATGAGCT
TGCTCAAGTCACTACGCTGTCATCGCCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTTTGCTACGTGCTCTTGGGAGC
GAGGAGTTTAAAGACTCGGACATAGAATTGTCGGCACGTTTACGTGCAAGGCTACATCGATATTCCATCGATAATGGCCTGTTGTGCTATCGCACAGATA
TTGAGGATAACCTTCGTATCGCTGTCCCTCATGATGAGGAGTTGAAGTATCGAATACCCTATGAGGCACATGATACCGCTTTAAGTGGTCATCTTGGTCG
TGAGAAGACCTATAGCTCAGTGATCCAGGCTTATTGGTGGCCCAAACTGTACAAGTAGGTGAGCACCTATGTGCGTACGTGTGAAACGTGTCAACGGGTT
AAACCCTCAGTAAATGCGGCAGCGCCGCTGGCTAGTCTACCTGTATCCACTGGGTGTTGGGATTCCATGAGTATGGACTTTGTGTTTGGCCTACCGAAAG
ATTTTGAAGGCAACACTGGCATTGTGATCTTTGTTGACCGATTGAGCAAGATGGCTCATCTAGCGGCAGTGCCGGACTCTATTGATGCCGAAGCTACAGC
GAAGCAGTTTATCGACCGTGTGTTCGACAACATGGTTTGCCAGTGGCAATTGTCTCTGATAGAGATCCCCGCTTCACTGGAAAGTTTTGGAAGTCTATCT
TCAAGGTGCTCGGCACCCGTTTGGACATGTCCATAGCGGATCACCCGCAGACCGATGGTCAAACTGAGCGTGTTTGTCGCGGCATTAATGACATTTTGCG
CAGTGTTTGCGCTGATACGCCTAAGCGTTGGAGATCCATGCTCCCTGTTGTTGAATTTGCGTTGAACAACGCTGTTCATGCCTCTACAGGCTATACTCCG
TTCTATGTAAACTGTCTCACCCACCCTCGCGTTCCGTTAACGCTACGACTATGTGGTTCAGGGGTTGGGGGGGGGGAGAGGTTGGGGGGGAGAGGCTGCC
GATCGGCTTGCTGATATCAGCCCTGATACTGTTCAAAAACAGGTAGGCGAGTTTCTCGCAACGCGATTGAATGTCTTAAGACATGTGCGTGACGCAATGG
CTGAAAGCCAAGACCAGAAAAAACAACAAGCAGATGCTAAAAACAGAGGTTGTATTGAACGTTATCAGGTCGGAGACCAAGTATTACTCAATGCTAAAAA
CCTACCTACGAATGTAGTGTCGGCTGTCTTCAGAACAAAGTTGTGTCCGCGCTTCATTGGACCATTTACGGTCACTGCCAAGAAAGGACTTGCGTATACG
CTCAACCTTCCACGCAAATTGCGCACACATACCGTGTTTTACGTGGGCTAGCTTAAGCCGTATCGGGA