Description :
From Genome Similarity Track
Location :
contig_1:270298- 273311
Transcript NameFunction/comments
g97.t1hypothetical protein
g98.t1hypothetical protein

Sequence
3013 bases(100 bases per row)
ATTTTCTCCGATTGCGAGGCCATTATGGCACTTGTAAGTGCATTTTCCTCTTCTACTGCCTCCGGTTTCTCCACTCCCTTGACGCAGAAGAGCGCGATCG
ACGGCTGCGACTTATCCACCGCTCGGGCAGCTCTGCGCGACGCTCTGACCTTCTTCCTAGCGCCTCTTCTGGCCCAGTGCGCTCTCTCGTCGAACTCGGC
ATCGTCCGCCTCGCTGTCGATCTCCTCCACGAGCGAGCGCTTGTCGGGGCTAATGCGCGTGATGGTCTCCTTGGCACGCAACTGTGCGAGGCTGATGTCC
AGTGGCGAGTCGCTGCGGTCCTCGCTCTTGTCCTGCGGCTGGGATTCCGACGTATCGAGCGTGTCCGAGACCTCCGACTTGGGGACGCTCAGCCACGAAG
ACATGCCTTGGGACGCCATGCGCACAGAGCGACGACCAAGCTCTGGCCAAAATGTGCTTCCCGCCAAATTGCTTTAAAAAGCTATTGTTACTTTACGGTT
ACATGTTATACCACTTCAGAGGACTCGTACCGCTTACTTTACGTGCGACGTGTGTTGAGATCGCACTTCAAGACCTGATCTGCGCTGGACGAAAGCTGAC
TGCGGCAAAGTCATGAAGCGAAGCACGAGAACCTCGTCATGGAGTCGTACAACCCGATGTAGCATTGGATGTAGTCATCTATCAGTGCGCTGACTTAGTG
AAATTCTCTAGTTGTAGCCTGCACCTAAAGTAGACCATGCGATACTGAAAATGAATTGGGCGACGTGTTACCTACTGCTGTAGCTCTCTCTCGCAACTAG
TTACTCGGTTGGCCCGATGCATCAGCCATGGGGACTGAGTTCGGAGGCCCATTCATCTGCATCGGAGCCATTCCTTGCTGGGGCATCTGCATGTTCTGCT
GGGACATGCCTTGTTGGCCCATGGACATGCTTTGTTGCGGCATCGCCATACTCTGCTGGGGCATTGCCATACTTTGCTGAGGCATTGCCATGCTCTGCTG
AGGCATCGCCATACTTTGGTGAGGCATACTTTGCTGTTGCATGCCCTGTTGGGGCATTCCTTGTGTCGCCGGATTCATGCGCTGCATTTGCGTGGGGGGA
ATCATTCCATACCCTTGGGGGCCCATCTGAAAACCCATGTTGGGAACCATGCCACCTCGGTTATCTGCGTAGCTTGTTGGGACCTGCATGGCGTTGCTCA
TGCGGGCCGGGTGAGACATCGGTCCACTGCCGGGGACGCCGTAGGGCATGCCGCCGTTGGCATATCGCTGCTGTTGCTGTTGGGCCATGGGGTTCATTTG
TCCATACTGCTGGGCCATCATTGGGTTCATGCGTGCCTGATACTGAGCCTGGGCTTGAGCATAGGCTTGGGCCTGAGCTTGAGCCTGCGCCTGCGCCTGG
AGCCGAGCTTGAGCTTGCGCTCTCGCTTGCGCCTGAGCCTGAGCTTGTGCCTGGAGCTGAGCCTGGTTGGCCATGGGCATCTGCATCATACCTGAGCGGG
CGTACTGCTGCTGAGGGATCTGAGGCTGCCCGTAGGCCTGCGGCTGTCTGGGGGACGTGTCGGAGGACTCGTCGGCCCACTTGGCCAGCGTCATGAGGTT
TTTGTTGAGGTTCTTGCGCTTCTTGTCGAGCTTCTCCGTGAACTCCCCCAGCTGCGCCGTTCCCTTGCCGTGTTTGATCTGCGTGTTGAGCTCGATGATC
TCCACGATGAGGCTCGAGTTCTCGTCCAGCATGGCCTGCGGGGACAAGAGGCAAATCTCCGGTCAGAGACCGATAGAGACTGCGCGTAGGCGAGATGACG
CACCTGGATCTGCTCCGTCGTGACCTGCTTGGGCTCCTGCGTCTGCTGCGGTGCCGCGAACGCGCGGTTCACGGCCATCTGCGGAGCCGCCGCCGTCGCC
ATGTCCATCGCTAACGTTATGTGCTTTTCCAGGTTTTCACGCTAGGGTCAGTACTGTGATATTTAGATTAAGTACGATCGTGGGATTTGTTGATAATCAA
ATAGTGCGCTATGACTGGCTAAAAAGTGGACGCACGCAAACCGCTGGTTTTCGAGCAATAGCCGATATCGAGCGAGTATGAGCGGTATGCAGCGCTTCCT
CCGACTGAGCGCGACCGAGGCCGAGGCCGCCATGAAGCCCAAGCTGGTGGAAGGCAAGTGGAAGCAGCCGCTGATCTCGGGCCGCAAGGTCGCCATGGTG
AAGAAGCACGCGCTGCGCAACGGTCTCGTGGGCACGTGGGAGGAAGGCAAGGGCGGCTGGCTTGAGACGTGGGACAGACCGCAGAAGCACCACGTGATGC
GGCCACTCAAGGGCCATAAGAACCAACGCAACGAGTTCGATCGGTAGGTTATGGGGCGATTGAGTGAGTGGCGCCTTGGGGTAGAGACTGATAGGTGTGT
GTGTGTTGCTTGTTGCTTGCTACAGCGTCAAGAAGGTGCAGGCGGCTATGGCGGCTATGCCCAGCAAGATCGCGGAACACAAGAAGGCGGTCAAGCAAGC
CAAACCCCTCAAGGGCCTGGAAAAGTGGCTCAACGAAACGGACCCGTACTAGATGTAGAGCAGAAGCAGAGCCAGGAGCAGGGATAGGAACAAGGAGACA
CAACACATGCGGACACGCACCTTTTTGCTCCACTCTAGGCCGCGGCGTTGAAGGGGTTGCTGTATTTTGTTTGTTGTTGGTGATGTGGCGGCTGCAGCAA
CTTGCTACTGGATGACAAAGCCAAATTTGAGATGCAGCGAAGCCTTGCGTGGTCTGTTTGATCGACTCTGCGATGGTACGCAAATACTATCGACAGATAC
GAAGACCCTCTCGGATACCTTCTTGCTGCAGTAGTAGATGTTACAGCGCCGTTCAACAGGCCTGAAGCGTCACGCGCCCGATTAGTCGCGATCTGCAGTT
GAGCAATCGAAGCCAAGCGAAGGTGTCGCTGTGCGGAGCTATAGTGCAGACAACAACTCAAAGCATGCGCTTATCGAAGCATGGCCGAAGCAAGAAGGGA
CACGTTGCCCCAA