Description :
From Genome Similarity Track
Location :
contig_1:270285- 273298
Transcript NameFunction/comments
g80.t1hypothetical protein
g81.t1hypothetical protein
g82.t1hypothetical protein

Sequence
3013 bases(100 bases per row)
TGCTATCAACTGCCGAGGCCATCTCCAGTCCAGCGCTCGCCTTCTTCTTCCTCGCTTTGCTCTTCTTCTCGGCCGCGATTTTCTCCGATTGCGAGGCCAT
TATGGCACTTGTAAGTGCATTTTCCTCTTCTACTGCCTCCGGTTTCTCCACTCCCTTGACGCAGAAGAGCGCGATCGACGGCTGCGACTTATCCACCGCT
CGGGCAGCTCTGCGCGACGCTCTGGCCTTCTTCCTAGCGCCTCTTCTGGCCCAGTGCGCTCTCTCGTCGAACTCGGCATCGTCCGCCTCGCTGTCGATCT
CCTCCACGAGCGAGCGCTTGTCGGGGCTAATGCGCGTGATGGTCTCCTTGGCACGCAACTGTGCGAGGCTGATGTCCAGTGGCGAGTCGCTGCGGTCCTC
GCTCTTGTCCTGCGGCTGGGATTCCGACGTATCGAGCGTGTCCGAGACCTCCGACTTGGGGACGCTCAGCCACGAAGACATGCCTTGGGACGCCATGCGC
ACAGAGCGACGACCAAGCTCTGGCCAAAATGTGCTTCCCGCCAAATTGCTTTAAAAAGCTATTGTTACTTTACGGTTACATGTTATACCACTTCAGAGGA
CTCGTACCGCTTACTTTACATGCGACGTGTGTTGAGATCGCACTTCAAGACCTGATCTGCGCTGGACGAAAGCTGACTGCGGCAAAGTCATGAAGCGAAG
CACGAGAACCTCGTCATGGAGTCGTACAACCCGATGTAGCATTGGATGTAGTCATCTATCAGTGCGCTGACTTAGTGAAATTCTCTAGTTGTAGCCTGCA
CCTAAAGTAGACCATGCGATACTGAAAATGAATTGGGCGACGTGTTACCTACTGCTGTAGCTCTCTCTCGCAACTAGTTACTCGGTTGGCCCGATGCATC
AGCCATGGGGACTGAGTTCGGAGGCCCATTCATCTGCATCGGAGCCATTCCTTGCTGGGGCATCTGCATGTTCTGCTGGGACATGCCTTGTTGGCCCATG
GACATGCTTTGTTGCGGCATCGCCATACTCTGCTGGGGCATTGCCATACTTTGCTGAGGCATTGCCATGCTCTGCTGAGGCATCGCCATACTTTGGTGAG
GCATACTTTGCTGTTGCATGCCCTGTTGGGGCATTCCTTGTGTCGCCGGATTCATGCGCTGCATTTGCGTGGGGGGAATCATTCCATACCCTTGGGGGCC
CATCTGAAAACCCATGTTGGGAACCATGCCACCTCGGGTATCTGCGTAGCTTGTTGGGACCTGCATGGCGTTGCTCATGCGGGCCGGGTGAGACATCGGT
CCACTGCCGGGGACGCCGTAGGGCATGCCGCCGTTGGCATATCGCTGCTGTTGCTGTTGGGCCATGGGGTTCATTTGTCCATACTGCTGGGCCATCATTG
GGTTCATGCGTGCCTGATACTGAGCCTGGGCTTGAGCATAGGCTTGGGCCTGAGCTTGAGCCTGCGCCTGCGCCTGGAGCCGAGCTTGAGCTTGCGCTCT
CGCTTGCGCCTGAGCCTGAGCTTGTGCCTGGAGCTGAGCCTGGTTGGCCATGGGCATCTGCATCATACCTGAGCGGGCGTACTGCTGCTGAGGGATCTGA
GGCTGCCCGTAGGCCTGCGGCTGTCTGGGGGACGTGTCGGAGGACTCGTCGGCCCACTTGGCCAGCGTCATGAGGTTTTTGTTGAGGTTCTTGCGCTTCT
TGTCGAGCTTCTCCGTGAACTCCCCCAGCTGCGCCGTTCCCTTGCCGTGTTTGATCTGCGTGTTGAGCTCGATGATCTCCACGATGAGGCTCGAGTTCTC
GTCCAGCATGGCCTGCGGGGACAAGAGGCAAATCTCCGGTCAGAGACCGATAGAGACTGCGCGTAGGCGAGATGACGCACCTGGATCTGCTCCGTCGTGA
CCTGCTTGGGCTCCTGCGTCTGCTGCGGTGCCGCGAACGCGCGGTTCACGGCCATCTGCGGAGCCGCCGCCGTCGTCATGTCCATCGCTAACGTTATGTG
CTTTTCCAGGTTTTCACGCTAGGGTCAGTACTGTGATATTTAGATTAAGTACGATCGCGGGATTTGTTGATAATCAAATAGTGCGCTATGACTGGCTAAA
ACGTGGACGCACGCAAACCGCTGGTTTTCGAGCAATAGCCGATATCGAGCGAGTATGAGCGGTATGCAGCGCTTCCTCCGACTGAGCGCGACCGAGGCCG
AGGCCGCCATGAAGCCCAAGCTGGTGGAAGGCAAGTGGAAGCAGCCGCTGATCTCGGGCCGCAAGGTCGCCATGGTGAAGAAGCACGCGCTGCGCAACGG
TCTCGTGGGCACGTGGGAGGAAGGCAAGGGCGGCTGGCTTGAGACGTGGGACAGACCGCAGAAGCACCACGTGATGCGGCCACTCAAGGGCCATAAGAAC
CAACGCAACGAGTTCGATCGGTAGGTTATGGGGCGATTGAGTGAGTGGCGCCTTGGGGTAGAGACTGATAGGTGTGTGTGTGTTGCTTGTTGCTTGCTAC
AGCGTCAAGAAGGTGCAGGCGGCTATGGCGGCTATGCCCAGCAAGATCGCGGAACACAAGAAGGCGGTCAAGCAAGCCAAACCCCTCAAGGGCCTGGAAA
AGTGGCTCAACGAAACGGACCCGTACTAGATGTAGAGCAGAAGCAGAGCCAGGAGCAGGGATAGGAACAAGGAGACACAACACATGCGGACACGCACCTT
TTTGCTCCACTCTAGGCCGCGGCGTTGAAGGGGTTGCTGTATTTTGTTTGTTGTTGGTGATGTGGCGGCTGCAGCAACTTGCTACTGGATGACAAAGCCA
AATTTGAGATGCAGCGAAGCCTTGCGTGGTCTGTTTGATCGACTCTGCGATGGTACGCAAATACTATCGACAGATACGAAGACCCTCTCGGATACCTTCT
TGCTGCAGTAGTAGATGTTACAGCGCCGTTCAACAGGCCTGAAGCGTCACGCGCCCGATTAGTCGCGATCTGCAGTTGAGCAATCGAAGCCAAGCGAAGG
TGTCGCTGTGCGG