Description :
From Genome Similarity Track
Location :
Scaffold_29:27024- 28637
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_29-fgenesh-gene-0.8Sialin
Pytiw_DAOMBR242034maker-piw_contig_29-fgenesh-gene-0.19Crp1

Sequence
1613 bases(100 bases per row)
GTCTCGTCTTCCACTTCAACGCGTCCGACCAGTCGATCTACAACACGAACGCTGGTAATGCCACGACTAGCAGCAGCCCCGAGTACGGCATGCGCGCGCC
GCTCACACCGAAAGAGGAAATGGTCGGACTGCTTCTCGACGACGAAGATGACGAGTAAGTAGATAGTCTCTAGTGCTTGTGGCGGCCCTCGCTGTACCTC
CCGAGCGCGATCCTCTGTAGCTGCGCGGTCGAAATGTCGTCCTTTGCGCACTTGTTCTGCATTTCCATAAACAAATTTGTCGCTTGCACCCACTCTTCAC
GCTGCTCAGCCGCGAAGATCGCTTCAATGTAGCTCTGCGATGTCGGGAAGATCCGATAGGCCGCGGCGTCGCGCATGGTCGTGAAGATCTGGTCCACGAA
GGCGAATTCCCCAGCACTGTTGCACATTTTCATCACGCGGTTGAAGAACACGACGTTCGGCCGCACGCCGTACGTTTTTTCGAGGTCGCGCAGCACGACC
ACTGCGCGGCGCCACTGCCCCAGGTCCTCGAGTGTGTTGAGCAGCTGCAGCATGACACGAGGCGAGATCACGGCCGAGCCGCTCGTGTAGTGCCATTCTT
TCAAAAGCTGCATGACGTCTGTCACGCGATCGACGTTGCGAGAGCGACTGCAGGCCTTCAGGTAGCTCTGGAGACTCGAGTGGGAGAGCAGCTTGGTGAC
TTCGCTTAAGCTGTTGCCACTGTGCACCAGGTCGTCGAAGAACAACAAGACGCCTTGCGTGTCGCCACGCATTGCACACACTGCGATCGCCCGCGTGTAC
GTGATCGACGACGGCGGGACTCCGTTATCGTGCATCTCCTCGATGAGATTTGAGATAAGGCTCCGCACCTCCTCTGCCTCTTCTCGACGCGCTTGTGCAC
TGTATTCACGCTCCTGGTTCTCTTCATCTTCCTCATCTTCAACACTGTAGTAGGGCTCGCCTTCAGGGTTTTCACTGGCAAATACACAGTCTTCGTCTTC
ATCTTCCTCGTCTTTCTCGTCATTGTCCTCATCTTGGCCCTTCCTGCCCACCTTCGCAAATGCTTTGAGCACCATGTTGTACGACACAGCATTCGGCAAC
AGTGCTTCGTGTTCCTGCATGTGCTGCAGGATCTCGAGCGCCTTCAGTGGCGCACTCGCCGTCACACACGCCTGGAGAACGCGATTGTACGCATCGATAG
AAGCAAACCCGAGCTGCTCCTTCATCGCATGCGTGTACTCGAGCGCCCGTGCGACGTCTCCCTGGCGCCCAAACGCGTGGATCAGGTGCACAAACGTGGC
TTTGTTGGCCTGCAACAGCCCTCCGGACGACTGGATCCCATTAAAGAGCTCCAGTGCATCCTGCGACGAGCCTGAGCTCGCACACAACTGGATCGCGCCG
TTGAGTACGTCAATCGTCGGCTGGAAGTCCTGTTCGTCCATGAGGTAGTGGAGGAACTTGAGCCCCACGTCCACCTGGTCCTCATGCGCACACGCTGCGA
ACAACAGACTCAGCGTCGTGTCGTTCGGCTCAAAGCCCCTTTGCTTCATGGTATTGAAGAGCTCAAAGCACGTCTTGACGTCCCCAAGGCGCTGGAAATA
GTCGATTGCAGCA