Description :
From Genome Similarity Track
Location :
Scaffold_6:27022- 32409
Sequence
5387 bases(100 bases per row)
CTAAAAATAAGTGTCTGTAAGTCAAGGTCTTCCTCGAACTACAAAGCTGTGTAGCTCTGTTACAATTTTTAGCACTTGTAGTTAACCCTGCATTTGACTC
TATTAAGACTTACACGCGTCGAGAAGGAAAATATTTTTACCTCTCTGAGGTTCAATGCGTAGCTCTTAGTAAGCTTATCGCCTTGGTAGGCGCAGAACAA
GTCAGCCTTAATGTGGCGCAGGGTTCGGATGTGCTAAAGCGCGTCTAGACGCTGTTTTAAACTCTGAGACCACGTTAATCGTCCAGTTCCATGACCACGT
GCCATCGGCTATGTCAATCCGCTATGTACCTACAGCTAAGGATGAGCCCAATGTTCTGCCACTAGTTCTGGATGTTAAGGCTTTAGAGGGAAAAGAGAGG
GTCTCTCGTTCTCTTGATCCGCGAAGTAGAAATGGGCATGAGCTCCACTGCGCTCAAGTTGGAGAGACAACAGGTTGGCAAAAAAATGCCCAAACTCGGC
GTAGAGCTATAGAATGGGCACTGACGTGCGATGCGCATGTTGACGCCGTCTTTTTTATGTAGGACTTTCTTTAGAGACAAATATCTCGAGTGTCCACACT
TCTTAATCAGGCTTATTGTGTGCTATCACGCTTTTTAGCTTTCGACAGGGTCTCAAAGAATGTTCGTACCATATCCGGGAGCTGAGAACTCTTCTTGCAG
CTATGCAACTAGATCCTCTTTCAAAGAAGTCCGCTCAACCATCTATATGGAAGTGCTTCGCGCTAGGGTCGATAGAACAGAAGTCTTTCGAGTCTACCCG
CCAACCTTTGAATAGGCGGTGGCCATTGCGTTAACGTTGAGTTTAACTTTGAAGCAGAATGTTACAAAACCCATAGGCATCATACGGGTACATTCGTCAG
GTCTGAGCCCATGGACCTCACCTATGCTGATGGTGAATAAAGTTGAGCTTCAACCTGTGGAACATCAACGTAACACCTGTAGATGTCATATATGTGGAAG
AACAAAATACCTCTGTCCATCCTGTCCGCTGCAAAAGCTACGTGGTATCGGCCAAGTCGCAACCCGGGCACCAAATCTGATAGTGAGCATGGAGCGGTAA
AATGTCCACTTCCAGGAGGCGGGAGGTCCCTACTGGGGAAGAACTAGGTTCTGTGGAATTTCTAGTGGGTAGAGATTATCCTATCTTTGTATCAATGAGC
TTCGAAGTAGTTAGCACGGAGCGTGGATGCAAAATAGGCGTGCGAGTTGTGCCAGCAACATTGAAGGGCTTTGAGTGGCCATGGTCAATTTAAATGGACT
TGGGTACAATGGCTAATTATGTTCGATGCCCTTCCCCTGAAGCATATCATTGTATGCTGAGGTGATTAAAACGCAAGGAAATGACTTCATCACGGTTCTT
CTAGAGACAGGAGCACTAGTCATAACCCCCAAAGTTCCGTTGGACTTAAAGGTAAAACAATTACGAGACTTTGAAAGCATCAAACTTCTTTTTCTTGGAT
TTAGACTCGACTTATGATCTGATTCTTGATATGAATTCGCTCGAACGCCAAGAGCCTTAAAATGATTGGTGGTCTAAGACCTTAGGCACAACGAGTAATA
TTCCTTGTGGATATTTGTAGAGTCGTGAACCCACCACTGATAAAGAACAAAATCGCGATTGGCACGGGACACTAGCCAGGTCGGTCAGTGCGCTGGACAT
CGTAACTTCAGAGCTAAAAATTATTGAAGATGTCTATGAAGTTCGTACGGATCAGATCTCAGTGACCAAAGTGTAACAGAACGTACTCCGTTTATTAATA
CTCGTTGTTATATGTAGTCATTGAAGGCTGAAAGAATTGTTGATCAAGGGCCAAGGCATCAAAATTCATGCGTAAGTGATGCACGTGGAGTGGCACGTAA
ACTTTCACATAGTGAGGGCGTCTGTAATAGCACCCCACTGAATGTCGGTAATGGCGTTGTTGGCCAGACTCCGAGGCATCGAGAACTATGCACAACTGAT
GCATATGGAGTGGAACTTAAAAAATATCCACGGATTGAGAGAGGCTGTCATATAATCCCGTTAAGTGTTGGTATTGGTATTGTTGGCGAGAACCAGGGTA
TCTAGAATTATGTGCAATTGATGCGCGTAAGGTGACAAGTCGTCCAATGGGTGATGAGTTCAAGTTAGGTAACTTTTCACCGAATGTCGGTAGTGACATC
GGCTCTTGTATAGAGCAAGTTAAGGTCTCAAAGGCTGATACGATTATGTAGAATGGCGTTCGAATCTGTTGGTATACTCAGTATCTATGCAGAGAATGCA
GAGGCGCTTGATGGATGCTAGATGCAAAGTGTCTGTTTTATCACAAAGTGCAGATAGTGAACAGCTACATACCCTCATCAACGAAGTTACAGGTGATTCT
CATAGTGAAATTAATATATCGACCCTTCCATCTTATCAGGCTCTATTAGAGTTGGACGAAATGTCTGTAGATGAGTTTTACCAGAACCTGAAGGCTGGTA
TTGTATTCGACATGGTGATCGTTCTACCTGAATTCGAGTTGTACTCATTATCATTTTTAGAGAACTGTCCTTAAGGATACAAAAGCAACTCTCCATGCGT
GTAGTGGATCGTTAATTAATAAGAATCATTCCAATCCCTACTATTATTTGGTTAAGGAACACCAGGATGTGGTGTGTCATGACCCTCTGTCGTTCTTACC
TCCCGACAGAGGTGTATGTCATGAAATTGACCCTAAACCCTAAACCCTAAACCCTAATTCCTGGGAACAAATACTGCGTGCCACGGTAATCGCTTTTGAT
TAGGGAAAAGTACGAGGTTATGTATAAGTTCTCTTGCAAAAAAAATACGCGGCAGGTATGGTGCAAGATAGTAAATCTCCATCTCATAACGTCTGCCTTC
TGTATGTGAAATGGTAAGTGGTGCATTGGTCATGCTAACACGATTCCTTAGTGCTACGCTATTCCGGCACAACCTTCATTTCTATAAAGGATTTTCTTTA
GAGCAACATGTTTGGTTGTACCCTATACAACGCACTCACCTTAGTCGAGCATATTACCAATAACTTATGCGAGCGAGCTATCTTACGCGCACAGATGTTA
GTACTCCGAAAGGCATGCTTTGTTAGTGGCTAGCTATGAAACAGGGACAATACACCAGCTGTTTAATACACTGGCTATACTTAAACGTCTAGTCAAACGA
CTGTTGAATCATCAAGAGGTCCATCGTCGAGTGGAACACAGGAAGACAGATGTAAAAAATCACATAGACCTCTTTGTATGATTTGCTAGCGGAGGTTAAG
GGCATCCTCACCAATAAGATCCTCGCTAATGCCTCAAAGTGCATATTTGGTGCTGAGGAGGTTCCCTTACTGTAATTCTTCATACGGAAAAGTGGCCTGA
CAGCAGGCCCTGTATAGGTTAAGGCCATAATTGATTAATGGCTTGGACTTTCTAATTTCTTGCACAAGTATAGCTCGATTTACGCTGACATGACAAGGAC
ATTGTCCTATCTCCTGAAAAAGACATAGACTGATGCTGGAGTAGCATGGGATATGATGATTTTAAAGACCTTAAATGAGATCTCCTTCATGTCCCGATTT
TTGTCCTGCCTGATCCAGCGAGGCCTTTTAGTGTCGTCTGCGACGCATCCGATTTTCCATCGGCAGTGCTCTGTTACAAACAGCTATTGAAAGGCGTATG
TGTTTCATCACTTTTACTTTTGCCAGCACAAAGCTGCTGAAAGAATTGTCTTGATCATGACAAGGTGTTACTTGTTATGAAGTTTGCTCTGGTCAAAGTC
AGAGTACATCTGCTTGTCTTTTAGCCGTTTGTGATCTTTACTGAATATGCTTCACAGCGCACTTTCACTCAGTCATCTCACTTCTCGCGAAGAATGACTC
GTTGGTTTCCATTCTTTGCGGAGTAAAGGTTCGAGATGAAATACAATCCGGGGAAAGAGAACGCTTTAACGGATGAGTTATCACGCAGACCTAATTATGA
TCGTGCTCATGGGAAAATCTTGTCGTTGTCCATTTCGGACCTGATTCGTGCGGCATATGTCCGAGATGATCATTGTATATCTTTGGGTTACGTGCTATTG
AGAGCGAAGAAACTAAAGAATTAAATTTGAAAGTCTCGGCACGATTGCGTGCGCGGCATTATCGATATAGTATCTATCAGTTTCTATTGTGCTATCCCAC
AGATACCGAGGATACTCCTCGTACTGTGGTTTTATGTGATGAGGTTTTAGCGTATCGCATTCCTTATAAGGCGCATGACGCCATATTCAGCGGTCATCTC
GGTCGCGAAGTACCTATTACTCGGTTAAAGTCAGAGTTATTGGTGGTCCAAAATCTATAAGTGGGTCAGTGAATATGTGCGCACGTACGAAACGTGTCAA
TGGCTCAAAACCTCCGCACATGCATCTGCGCCACTGGCGATTCTACCGGTACCCAAGCGTGCTGGGATCCCATTCGCATGGATTTTGGGTTTGGCCTTCC
GATATATTCGTATGGCAACACTGGTATTGTGGTCTTTGTTGACTGCTTCATCAAAATGTCTTATCTAGCGGCTGTTTTGAATTCTATTTATCGTGGAGGT
ACAGCTCGTCTGTCTTTCGATTGAGTGTTTCGCCAACGCGGCTTGCCAGTATCAATTTTATCGGACCGCGACCCTCGTTCCACGAGTAAATTTTTAGGAG
TTCATCTTTCACGTGATTGGCACCCGTTTGGACATATCCAAGTCGGATCAACCTTAGACCAATGGTCAAATCGAGCTCGATAATTAATCGCATTTTCGAG
GATATTCTGCAAAGCGTGTACGCAGATGCGCCTAAGTGTTAGTCCTTTTTCTTGAGTTTGCTCCTTAAACTCTGTGCACGACTCTACGGGCTACACATCA
TTCTATGTCAGCTAACTCACACATCCGCGCGTCCAGTTAACTCTCTCACACACTGTAGTCTTGGGCTTGGTAGGGGAAAACTTGCCGATCAACTTGCTGG
TGTCATTTTAGCTTCTACCCAGAAGCAGGTGAGCCAGTTTCTCACTACAATCTTTGGTTCTTGTGACATGTGCGTGACGAAATAGATGAAAGACAGGATA
AACTAAAGGAAACAAGCGGATACTAAACAATGGTATGTACTTAAAGTTATAAGGTCGGAGACCAATATTACTAAAAGCTACAAAACGTACGGAGAAGTAT
AAGGTCAACAGTGTCTTAGCCAAAGCTGCTCCTGCACTTCATCGGACCCTTTACGATCATTGCCAAGCAAAGTTAAGTGTATACCCTGAACTTGCTCTCA
AATTACGTACATATCCAGTGTTTATCGCTGGCATGCTTAAGCCGCATCGGTAACCGACTTAAGTAGACGTAGAGGTGCTTGCACCAA