Description :
From Genome Similarity Track
Location :
Scaffold_296:2702- 4066
Transcript NameFunction/comments
Phyke_g7961microtubule -associated protein EB1
Phyke_g7962hypothetical protein PHYSODRAFT_460566

Sequence
1364 bases(100 bases per row)
AGTGGTTCAAGGCCTTCTACGAGCGAAACGCTGCTGGAGGGGCGTACGACGCAGTCACACAGCGGGACAAGGGCAAGGGAGGCGCTCAGTTCACACAAAA
ATTCGGCGGAGGGGCCCCAGCCTTGTCCGGAACTTCAGCGGCGCCCATCCGGCGGaaagcagctccagttgccACGTCGAGAGTTGGACGGACccctcct
gcagctccagtaggAGCGGCCAGAACTGCtaggacgacgacgagtgcAACGCGTCGTCCGACGGGTAGCGCTGGTACTACTGggggtgctgctggaggtg
ctgctggaggtgctgcgtcGGCGGCTGATACGGAGGcggctgtggctgctgctacggAACCTTTGGAGAAGGAGATAGAGGAACTCACGGCGAACAATGC
GGCGTTGACCAATGAGAGTGGAGAGCTCCGTGCTATGGTAGGTTGGGTGGGATGTTTGGGCAGGTAGGAAAAATGAAAGTAACATTGTGGTGATTGACGT
GACAGGTGGAGAGTTTGGAAAAGGAACGAGACTTTTACTTCAACAAGCTGCGTGAGGTCGAGATCATGCTGCAGTCGGATGAAGGCAGTGAGGTGAATCC
GCTGGCACAGGCCATCTTGAAGGTGCTCTACGCcacggaagaagacgcagcggaggaggaacagGTCGCGGGCGAGCCACAGGACGAGCAGATGTAAAAC
TGGCTAAGTGAATCAAGTCAAGCGATCGTAATGCTCCAAACTGGAAGCCACATCAAAGGCGTGCACTAAATTCCCGCAAAGAGGGCGACTGAAGTCGCAA
GCAATCGACAAGACGTAGGCTTACATGTCAAGGTCTACACGAATAAAGCCATGCTAATTGAGCTAGCGGTATCCTTACGCTTGTGTGTACCTATGCTCGA
TGATGTCTCATTGCCGACGAAAATCTGTAGTAGGCAATGTAACCCTCGGACCACTGCATTCATTGAACGATATCGTATTCCGGTTTAGTTCGCGCTGAGC
AATAAGTTGCGCTGCCAGGTCATGGAAAAACAAAGGCATGGGGAGATTACTAACAACAAAGACATATCCTCTTGATGTATTTTATCCGTCGCATCGCAGC
AGCTAGCAATGACCACCAGGAATCTCAGGCTCCTCGTTTCCGGGCTCTACGGTTTCGGGTGCGTCAGTAGTCGAAGATGGAGCTATGGTTGGGGGCATTG
TGGTCTCAGATGGTGTAGTAGATGCTGGTGCGCTACTAACCGGGGTTTCCGTGGGCTGTGACGGTGCAGCTGAAGTCGAAAAGGGAGTCTCAGTTGCAGT
TGGAGCCTCGCTTGGTGGCGTGCTGGTGGTCGGAATTGTGTCAGCTGTTGCAGCGGGAGTCATT