Description :
From Genome Similarity Track
Location :
Scaffold_37:270139- 282682
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13870hypothetical protein
Phypa_INRA-310PPTG_13871long-chain-fatty-acid-CoA ligase
Phypa_INRA-310PPTG_13872hypothetical protein
Phypa_INRA-310PPTG_13873hypothetical protein

Sequence
12543 bases(100 bases per row)
TATTTCGTGGGTTTCGTGGACGGCGTGACGCTCGAGTGATTGTACTTGGACGTGGCTACGCATCTCATCCTCGAATTCTCATCTTGATGAAGTATTCCAT
CTACACTCGTGACCTCGCGGTGATTTGGAAACACAAGCGCGATGCTGGTATGGTCATTGCCTTCTCTGTACAAAGAAGATATCGAGGATTTTGTGGACGA
CGTGAGGCACGCCTACGCCTGGCTCGTCAGCGACAGCGCTGGTATTTGGAAGACACTGGAGCACGAACGATCCAGCATTTCTTCCGCAGTATCATGTTAG
TATATCTTGCTGGTGAAGGAGACTAATTCGTGATCATTGTACTTACCACTTTTGTGACTTCTGCGCAGCATTCTAGTGCGCCTTGCACGGTTTGAAGCGC
TCTTGTGTCTCCGACGACGCAGTGCGACCAAGATCCAAGCTACGTGGCGGATGTGGCTCTCCAAGGCGTTGGCAACAGCGCGGAGGTTGCGAAATGATCG
TCATCGTCAACACACGGCAATTTTGGACGCTATCGCCTCTCCGCAACAAGATCGTCGACTATTTCTCCACCGAGGTGCTGTGCATTCGATTGTGTCGCTC
TACCGTGCGTCACTGACAACGCGTGGTTGGCTGACACCAACGTACATTAAGCTATTGCACCGCTCAGCTACTCAAATTCAGGCACTTGTGCGTGGTCACT
TCGGACGCGTGTATACGAAATGGTTTCGATATGAACTCACCCGAGCGGCAGCCATAGTACAGCGTGTATGGCGAGGTAAGTTAGGCAAAATGATGTGGCG
GTCTCTCATGGAGGAGCGACAGCAGCTTCGTCGTGTCCAGGAAGAAGGCGATCGAGCTGCGTTGATAGCGCAGAAGCAAACAGCTCATCACGCTCTAGAA
GCTTTCGAGCGTGAGACGCAACATGTTGTTGTACTGCAGCGCTGGTACCGGACTTTGAAGAACCGACAGGTATTCCGTGAAGCTCGTGATCATCGGGATC
GAGAAGCACACACACGAGCCGAGAACAAGGTGGATGGGGTGCTTCGTAACGCAACGGGAAGTGTTGTGTTCCAAGCTCGAGTGTGGCGCGACTGCGTGGA
TCGTAAAACTGAGCTTGTGGCACTCGAAGAAGGCCAGTGTGTGGCAATGGAGAAGGAGATTGAAGAGCTGAAAAAAGCGTGTATCGAGGCGCATACCGGT
TCGACTCAGGCGTCTCGAGAATTTGTCGAGTTATCGAAACGCAAGAACGAGTTCGAACGTTCTCGTACGCGCAGAAAGAAAGCCACTGAGGCAGTCAAAC
AACGCATCCAGCCGTTTGCTGTTCGTGCAAAGCAACTCACAATGGAGAGTGCACGAGAGTTGAATGCCAATCGACAGCTTCAAGTGGAGTTGCGACGCAT
ACGAACGGAGCTGCGGAAGTTCCACGTAAATTTGCGAGGTCGACTACCAATGGAGCCTTTGTTGCTGAGTGGGGATATCGAGTCACTGCTGGCTGGACTA
ACCGGTGAGGGTACATCCGACGATGAAGACACAACAACGACATGATCATTCCATCGTGTTAATAGAGCTCTATCACCCCTGTATCACATCTTAAAGCTTA
CTTTGCTCCTCATACATTTCATGGATGACGTCACTAAATATTGGATGAGTTCAAAGCGTTTGGGTTTGAAGGTGGGCGTGGCAAGACCGTTTTCCGGAGT
GAACTGATCCGCATGCAGCCTCAACTTGTGAGCCCGCTCGAATGGAAGCAGCTTCGCAGTCAGAGCCAACTGCCGCATGTCTTCCTGAATAACACGAAGG
AGCGTGTTGTTGCCAGGAGCACATAGCGTTTCCAATGAAGCTTCCTCCCCCTTAAGTCCCTGATTTTCAGCCCAAACAGAACCATACTCGGGGTCTGGTA
CGACGATACCTACCATGTAGTTCTTGAACGAATCACCGTGGACGAACACTTGGGCAACAAAAGGACTCTGACCGTACACACCCTCGAGACGTTCAGGCGA
CACGTATTCGCCCTGCGAGAGCTTGTAGATGTTTTTCTTGCGATCAATGACCGTCAGCGTACCATCCAGATTCCACTGACCGATATCTCCTGTGTGGAAC
CAGCCATCGGCATCCAGTACTTCGCTCGTTAACTCTGGCTGCTTGAAGTAGCCTTTGAAGACGTGTTTAGATCTGGTCAGGATCTCACCTCGAGGGCATG
GCGTATCGCGAGTCAAGTAGAGCTTTTCCGGGACATCTTCCAGGCAGATCTCTGCACCAGCAACGGGGATCCCCACATGTCGAGTCATTGGCATATCAGC
CGTAGCACACGACACCACCGCAGCAGTTTCCGTGAGTCCATATCCTTCCAGCACAGGGCAACAGAACACAATGGCCATGAACTCCTTCACCACCTTCGAC
AGTGGGGCAGAACCGCTGAGGATATAGCGAACACGACCGCCCAGAATCATCTTGAGCTTGTCGAACACCAAACGGTCCCAGAAAGCGTGCGTGTAGTACC
CCTGTGCAAGGTACTCCTTCTTAGCTGCATATGCCTGGTCGAACAAGAGCTTCTTCACACCACCAGCGGCTGCAATGCCTTGCGTGATCTTGTCATGAAT
TCGATTCATCAATCGCGGCACGGATGGGAATACTGTCGGTCTCAGCTCTGCCATGTCGTCCAGTAGTTTGGTAACGTCACCTTGGTAGTAGCCGATGCAT
CCTCCTTTGCCGATGATGTGAGCCTGTACATTGCGCTCGAAGCAGTGAGCCAACGGCAAGAAGGACAGATGAACATCCGACTCGTTCAGTGGTGTGATTT
CTATGGAGCACAAGATCGAGGCGATCATGTTGGAGTGTGTGAGCATCACACCCTTGGGGTTACCCGTTGTCCCCGATGTATAGCAGATGGTGCAGAGGTC
ATCAGGCAGAGGTGGGTCAGCTTCCACAGGGTGGACGAGGCCGATTTCCATGAGCTGATTTAGCGTCATGAGCGACACGTTGTTGGATCTGGCCAGACTC
ACGTCTTCACCATCGATCTTGGCCTCGAACTGCACGATAGTCTCGATACTTGGACAGCCTTTGACGCAGGTCATGAACGTTTTGACCTGATCCTTGGCGC
AGAAAACTACTTTTATCTCCGTGTGGTTGATGATGTAGGGCACAACCGTGGGGCCCAGGGTGTCGTACAACGGCACGAGCGTGTACGCCATGCGATTTGT
GCTGTGCTCTACAACAGACCACTCGTAGCGGTTCTTACTAAAGATTCCCACTAGTGCTCCTCGGTGTAGTCCGAGCTCCTGGCTCATACCAGACGAGCAG
TTCTTCACCGCGATGAGAAACTCATTGAGAGTCACCCACTCGTAGGGCCCGACGTCTCCGGTTTCGAAATCCACCGTGCGCGTGCCGAAGAGTTTGTGCG
AACCATCGGGGTCGATCTCCAACCGACTTAGCAGGTTTGTGTACAGCGTGAAGTTTGGGTCGAAGCCGGAGCGCAACGTGGATACGTGCACGGGGCCGCG
GGTGGCTGTGGCCGTACCAGGCAGTTCGCGTGAATGAGTCAGCTTTGCCTGGGAGGATTCAGCGGTGGTGGCGTTCATTGTTAAAGGTGTTGTATCGCCA
AACAAGCTCTGTGAACAATGCGGTCAATTGAAGACTGACGAGGAGCCTCGTCGAGGTCACGCGTCAGTGCATCATGCAGCAGTTGATGCATGAATATGTA
TTGTCAATTCTGTTTCAATAAGGCAACAAGAATCTATGATTGGTCCAAGATAAGAAACAGCTCTGATTATTGGCCCAAATATATCCAATGAGACGCTGGC
TGCATGTTGAAGTGCTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACACAACAGCAGCGTCAATGGCTGTTTAATTACTACCAA
GAGCATCCTCTTGCGTATCTCGACGAAGCCCAAGATGCTTTCAAAAAACTCATTGTGTTGACATCTCAAAAACGTCAGTCTGGAGAATAATACACGCGTA
TGGCCTCAGGTATTGGAGCAACGCGCGATGCACATCAAGGAACGTGACGTGTTCCGCTTCGTGGAGGAACTAAGCCACGTAGATTGGAGCCACCAAAACA
TTGTCTTCCTGGGCGAGGTCAGCTTCGACAACAGAGGAATGATACGCAGCGAGGTTACACTATTCGTGGGAAGAAGGTTGCTATTCGGGGTGACTTTGAA
TGAAAGCCACGGGTTTCAATCCTGGTGTTTATTGGCGTTAATGGGGTTCTAGACTAGTTCAACACGGAGGGCACATTTGACCGAGTGGAGCTCACAGAAT
GCTGTCAAGATTTTGTACATTGCCCAAGTGGACCGGTTCGTCAATACCCTGGTCGAAATTCAGTCTGGATTTTGGATGGCGCTACTATTCCCAGGCACAT
AGAGGTTGTGCACTACCTTCGCAGTGTTGGTGTTGTGCCCATTTTCCTTCCGGCTTATTGCCCTTTTTCAACCCCGATAGAGTTCCTGTTTGGCTACGTG
AAGCGCTTATTCCAGCGACACTACCTCGAATGTAGTGGGCGTAATATTATGCCTTTTGTTGTTCAAACGTTCCGACGATACAATCTCAGCAAGGTATTTC
AGCACTGTGGATTGAAGATTCAAGGTTACTTTGATCCTGTGCCCCTTTCGATTGAAAAGCAAACGCAACCAGAACTCAACACACTGACGACCAGAAATGA
TGACTTCGAGTTTACTGCACTTGACGAGGAATCGTAAACTAGTCAAAGTACGAAACGTTTTAGCTCTCACACTTGAGATATAATAGAAAACTTGCTTGAG
TATGGTGGTTCGTACTCGGCGTGCTCTGTGTCTTCGATGTTCTCAATCAGGGGCATCGGGTCGATGATCGTGCTTGGAAACGGAGGCACGAGATCGCGAA
TAATGCCTTCAATGATAGCTTCACGTGCTACCAATCGCTGTTCTGGATCGTCAAGGTAACGTCCAGCAGATTCAAGGTAGCGACGGAGCTGCTGACAGTC
ACCGATAGAGGCTCTCACACAGTCTAGCGCCACACTGGAAGATTGCACTACTCCATTTAAATGCTCCTCAAAGCGTGGCTCTGCTGGATCGAGAAGGTTT
CGGTGATGTAGCTTAGCGGTGGGTTGGCAATACTAGCATTCCAAGTCGAGCGATTCAGATTTCGCGTCACGTGGTTCGCCCACATACGCCAGACAATCGA
CGATGCCTGAAAAGTATTTCTCCACTTCTGTCGAAGCGCCTCCACCACTTCTCGCAGGGAACTATCTGCTGTTGCACCTGCACGATCCGTCTCTGGTAGA
ACGCACGCCTTCATAAAGTCATCTCGATCTTTAGCAGTTGCAATGGCCATACCGTACTCATAGACCATGAGAGTCACAGTAGTCCCTTTATTTGCAACGA
TCCACTGGTTCCATGCTTGTGCTGGCTTTGTAGAGTCAACAACGCGTTTTTTTTACCTTGAACTGCAGCAACTTTGCCCACTCCGAGAATTGAGGATCTT
CCACGCTCCAGATACCATCGGTCTTAACGGCTTGCTTCTTTATATTAGGAGAAAACTTCTCCCAAACAGCCTCCATAATGCTGTCAAAAGAACGTCCAGT
GAACACTTCATCACGGTGTACTTCGCCGGACGTATCCCGCTGGTTAATTGATGTCTTTATAATGGGTCGAAGAAGTAGTTGAAAAAGATCACCATAGCCG
CTTCATGAACTGATACAGTTTCTCCTGCCTCCATGTGTCTGACTGCAGCCGCAGCATCGCATTCAGGAGCGGATAGAGTCGCACTGGTCTCAACATGACC
GACAAAAGCAATCTCTGGAGCAGGAAGTGTCGCGCAGAAACCAGTAGAAGCTGTATCAGTGCGCTCTGAAGTCGATGTATTCTCCAACGTTCCACGAGAA
GCAGCAGCAACAAACTCGGAGGGAGACACATCGGTCCTGACTTCAGCAGGAGCGAGTGTTGAGGCAGGTAGAGTTGCCCGGGTACCCGTTCGACGCGCTG
GAGGACGCCCTTCTTCACTTGGTGAGCGATCCAGATGACGGACGGAGAGAGGCTCCCTCTCGTGGTGAGTGGTTGGCCACAATGTACGGCGATGTGCCAT
GGCCACGCCGGAGCGGGGATCGTAGTGGTGTCGACGCCATGCTTCAGTGCGGGTCCTCGTCAAAGAGAGAGTGAGAGTGATTGTTGGTGCAACCAAAGGT
TTATTCTGTAAGGCAGGTTTACAGGCTGGGGGTGTCTCTAAGACGGACGCGGAAATTTCGAATAGAACTCACAATAGTGGTTTTCCGACAAATGAAACAA
GTAGGATTATGCTGGATCCTAATGAGATGATATTTCAACCAATCAATTTGCCTAAAGTTAAAGTTTTAGCAAAAGAAATCACTGTAGGTAGGTATACCTT
TCGGGCACTTTCCGACAAATATTTGCCGGAATACTTGACAAAAAATGAATATGTACTGACAACCCGTTGGAATCCTGTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN