Description :
From Genome Similarity Track
Location :
Scaffold_271:2701- 6215
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_271-snap-gene-0.13Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_271-snap-gene-0.9Nucleolar GTP-binding protein 2

Sequence
3514 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCGTAGACATTACCATTACCATTGGGCGGTTCGTTCTGCACGAGCAGCGCTTCGAGC
CCGTTCGCGAGGGTGATGACGCGATAGCGTTTCTTATCGCTCGGCGATCGGAACTCGTCGAGTGNNNNNNNNNNACGCCGTCACAGACGCCATTCAAGAG
GAAGCAAAGGCACCAGAAACTTCACGATACTATAAGGAGACGCGCGCCGTGGCACTCCAGACTCTAAATGAGCATCGATTCGCAGTCGAAGGCCCAGACA
GCGGACCCTCCTCCGCCCCGCGTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCTTTGATGCCAATCACTGACCCACCATCATCGTCACTC
TGTCGCATGTGGCCGTTCTTCTTCCGCCCTCGTCACCTTGTCTATTCTTTGATTGGCCAAAAATAAAAATAGGTCAGTGCGATTGGATGAAAAGCGTGCG
AGAAGAACACGCCTCTAAAAGATACAATGCCGAGTTCAATGCAAAGCAAATAAAAAAATGACGATACATTTTTTATAGATTAGAAGCTCGATACATACAT
ATGCATGCCTACTCCATGGACGCGACGACTGCGCCGAGCGCCGCGGTGGACGCGCGGAAGGTCGTGATGACCGTCGCCTTGGCGGCCTTGAGCGCCGGGA
AGCTGAACGTCCTCGCGACATTCATGTACGGCTTGAGCACTTCGCCCGCAGACTGACCGATGGGCGTGTTGCGCACAAATTCAAAGGGCTCCGCGATGCA
CGACACGTAGAGTCGATCCNNNNNNNNNNNNNNNNNNNNNGCAGACTGTTGCGGTGCGCCACAAACACATTGTTGCGGTGCAGACGCATGGCGCCTTCGA
AGCCCGACTTGGTCAAGTAGCTGCACAGCAAATAGTTGCCACTGATCTTCTTCACGTGCAGCTCCAACTCGTCCACAGGCGCCAGCAGCGCCGACGGGTA
CGCACCAAAGCCTTCCAGTTTCACGACATCACCGACCTGCGGCTCCATGCCATGAGGCTCGTAATGGAGAATGATACGCACTTCACCAAGATCCACGGCC
TTCTCTGGAGTGCGTTTCGGCTTCTTACCGCTGGTGACGTTGTCGCTTGGATTGACGACGGGGATGCCGCCCGTGAGCGTGATCCAGCGGTCCATGACTT
CTTCCTTGCCCTCGAGTAGCGCCGTGAAGTCCACGACAGCCGTGCCGATCACCGATCCATTTTGCATCCCGACATACTCGGTGGTCTTGCCCGTGAGCGA
ATCCTCGTTCATGGCGTCCACAATGAGCTCCATGCGGATATCCGAGTGGTCGTCCAGCGGTGAGCGCTTGTGATCAAGCTTCGGGATCTTCATCTCGAGC
TTCTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCGCCACGATCGTGGAGCTGCGCACGTTCATCTTGCCGATGCGGAAGATCACA
TACGGGTTGCACGTGCGCACGAAGAACATGGACGACGCGGCACGCAGGTTGCGGGCCTCCACGAGGCGGATGGAGAGCGTGCCAGCCACGCCGTCCTGAT
GCGTGACGTGCTTCTCGAACTGGAATGACTCCAAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCACGCGCCGCCATC
TTTCTGCTGCTGCTGCTGCTGCTCGGCTTTTCTCTTGTGGGAAAATGATAACAAAATAAAAAACGGTGGTAACATTGGTCGGAAGTAAACGGAGACATTG
AATCTCCAAAGTTGAAACCTTTTGTCTGATTCATGTTTAAAACTCGTAGTTTATGGATGTGCAGCTGCTCACTACTGTAAATAGTATAAGTGTATGACCA
CTGATTGGCTAGAATAAATGCGACATATCACTGTCTACCTTCGATTGGCTGAAATGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTTTTGGCACCCACCAACCATTTAGCGCCAGCCCATTCAGTGTGTCTGCTTGATACCCGACCGCAGCGAAGAGCTCTTTGGCGCACGACG
AGAAAAGCANNNNNNNNNNGACAGCTTCCGCTCGCTTTGGCTTCTACACGCGCCCCACCGCTAGCATCTTCCGCCACCGCAGCACACTGCTCTCACGTGC
ATAGACACACACATATATACAGAGCGCGTCTCTCTCTACAGTAGATCATTATGGCGAAGGGAATCAACACGAAGAAGGCGAGTGCCGANNNNNNNNNNAC
CCGAACCGGCAGGTGCCCAAGCGCCAGAAGGCCGCCAACATGCGTGACAAGGCCACGATCAACCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGATGGGCAACAAGCAGGGCGGCCAGGAGA
TCACGTCGGGCTCGGCGCGCGTGCAGCCCGACCGNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTCAGAAGGAGCTCGACAAGTTCCGCAACGAGATGTCA
CTGAAGGCGGCGGACCCGTACTCGGTGGTGCTGCGCTCCCGCAAGCTGCCAATGGGTCTCCTGCAGGACTCAGAGAAGGTCACGCGCATGAAGTTGCTGG
AGACTGAGAGCTTTGAGGATGTATTCAACGGTAAGCGCACTCGTAAGCGCGCCAAGATCGCTGCGAACGACTACGAGTCGTTGCTGAGCCGTGTGCAGAC
GACCACCGATTCCTACGAAGCCAAGGGTAGCGATCGCAACATCCACGTCGAGCAGGACTTCAAGGTCGAAGTGTCCCACGATGTGTTCAACAAGGGCCAA
TCGAAGCGTATTTGGGGCGAACTGTACAAGGTGCTGGATTGTTCCGATGTGGTCATCCAGGTGCTGGATGCGCGTAACGTGCCAGGCACGCGCTGTGAGC
ATGTCGAGAAGCACATCAAGAAGAATGCGGCGCACAAGCACCTGATCTTTGTGATCAACAAGTGCGACCTTGTGCCGAACTGGGTGACGAAGAAGTGGGT
GCAGAAGCTGAGCGAGACGACGCCGACGCTTGCGTTCCACGCAAGTATGAACAACCCGTTCGGCAAGGGAGCGTTGATCAACTTGCTGCGTCAGTTCGCC
AAGCTGCACCAAGACAAGAAGCAGATCTCGGTCGGTCTTATCGGGTACCCGAACGTCGGCAAGAGTTCCGTGATCAATGCGCTGCGCAAGAAGCGCGTGT
GCAAGGTCGCGCCGATTCCGGGCGAGACCAAAGTGTGGCAGTACATCACTCTTATGCGCCGCATCTTCCTCATCGATTGCCCAGGTATCGTGTACGACCA
GGGCGACGACGAAG