Description :
From Genome Similarity Track
Location :
Scaffold_14:270092- 271169
Sequence
1077 bases(100 bases per row)
CGCTGAGTCGGAACCGGAAGGACTGCCAGCCGAGTGCTCTGATAAGGAAATGGGATTCAAGAGCGACCCAACGGCAGGATTTGTCGAGCCGGTGGACGGA
ACAGAACCATCACCAGGCCCTAACACCTCGTCGTCAGACGCGTCGAGATCCTCAAGCAGCTGAGCAGTCACAGTACGGGCGGTCGCAGCCGATCTCCGAA
TAGGACGCCCAGATGGGGACGTCAACACGGCCGTGGTCACAGGGAGAGACGGTCTGAGGACACTCACGGCCGGAGTCACTAAGTCAGTCGGCGTGGTGGA
TACGCTCAGACCCCGAGAGGGCGACTGGGAGTGTCCAACCACCGTTAGCACGACGCTGAGTGGTGCGCTCGACCGGGGCAACCCAGCGGAGATGGGCGAA
GTCGAGCCTGGGGCACCCACGCTCGTAGCCGGGACAGGCAGTGAGGCCACGACATCAGATGAAGATATCGGCGGTGGGCGAGTAGCCGCGACCGACGAAG
TCACCGGAGGGCCAGAAGACGAAGAACCCACCGAAGTCGTCGAAGCGACTGCAGGAACGGTGTCGGCGGGCGGCTCAGGCAACTCAAACTCAAACTCAGC
TTCGCTCGAAGCGTCACCGTCGTCTTCAGAGCGAGCAGAGACAGCGGGCTGAGTAGCAGAACTCAGCTGAAGGTGACGAACCTTCTTCCGCCGAGTCCGA
CGACGGGACTTTCCAGAGCGAGGCTTTCCTCCATCGGATGCAGTAGCTTGAGGCGAACTTGAGTGCAAAAGGGCACTGATAGCCTCGTGTCCATCCTCTC
CGGGGAGTGGACAAGCGTACGGTTGAGGCGGATGCGGCGCCGGCGTACGATGACGAGGACCTGCGGCTGTGGGAAACTTGGGGTTGGCATAACGCCGAAG
CTGCTGAGTCGAGGTCAAGTTTGCCAAAGGCGTACGGTGAAGCTGAGCAAGAGTCGGCTCAGCCTGAGTGGTTACCGCCGCCGAGCTGACTGGAGCCGCA
GCCGAGTCTGCCAATGAAGTCGTCGAAGACCCTTGACTAGCTGAGGGAACCACACCAGGACCAATAACGGAACTCGC