Description :
From Genome Similarity Track
Location :
Scaffold_1971:270- 3818
Transcript NameFunction/comments
Phypl_g14477Amino Acid/Auxin Permease (AAAP) Family
Phypl_g14478hypothetical protein PHYSODRAFT_261658

Sequence
3548 bases(100 bases per row)
CCGCCAGGTGTCTGCCTCGAGCATGGTTGAGAAGTCGGAGGGCCGTATGTCGCACCTGCGCATCGCCCTGGAGTTCGGCGAGGAggtcaaggaggaggaa
ctgCACGCGCCGTACCGCGGCAACCCGCTGCGCTACATCGCTCTCCGCATTTGCATCATTGCGATCTTGGTGGTTattgctgtgctgctgcgcaagcgct
TCCTCGACCTGCAGGACTTCACGGGCGCCACTGCCCACACGACAAGCTGCCTGCTGATGCCGCTGATCATCTACATGCGTGTGTCCTGGAAGCGGATGTC
GATCCTGGACAAGAGCGCGTCAATTATTGTGATTGTGGTGTGCGCCTTCACGGGCTTCTACGTCATGATCCACGCTGGCGAGCACCTGTTCGCGccgtcg
gacgacgacacgctgTTCCCGTACTGCGAGGAGGAGTTCATGAACGCCCCATACTACATCCgcaacaacagcaccaaCTAAGCCGAaaccgagctgcagc
agcgttcgAAGCAGCGCGGCTTGGTGGTATCAATATATCATAGTTTTGTGGTAGGATAGAGTTGTGATATCCGCGCCCGACATATTCTAATGAGCAGCAA
CACATACAGTGCCTTGTGTACTATTCAAAGTGTGGTGTATCCTTCTTGGCTGGACATTGTATGCGCGTTTACAACTAactgcatttgctgcacCAAGGAA
TACTGTCCAAGCGAGCTGTTGtacagtagtagtagtacgactactactgtagtactACTATTTAACTCTTACAAGCGTATAGACTTCTTAACGTTCTGGT
GTGGCGTACGCAAAGCACTGATAGCCATCGCAAGTTCGTGGCGTGGACTGTGAACTGCAACACCACAACACTACGCAAGCCACAACATAATGAAAGCTAT
GCTTCCCTATTACTGTTTGCTTTGCGTCGGGATTCTCATTTTATATAGTGAACCACTACGTATACATACAGCTGCAGTGTGTTCACCAGTCAGCCTCTCA
CGCTCGTACACCAGCGACGCGTGAAGCGCTACGATACCACGTTGCAGTCGCCGACCGCATGCCTGGACTACATGCCTCAAGGAAGGCTCGCTCATAACGA
GAAGGCGTATCCGTACGTGGATACGTAAcaaactacatgtacaatgCCGTAATGGTCATGGGACGCATACGACTTTTACGATGTCCATCTTAATTATTAA
TAGCATGTCTTGCCAGATGAGGCACTACGCAGCTCACGGTTTGTTCAGTTGCCCGTCGCTTTATGGTGGCTCGACTGCGCGCGCACACGCATGGAGCTAA
CTAAATATAATAGTCTGTGTGCTCATTCCGGAACCCAAATATTTCCAGCATACTACTACAGTATCCGAATAGTACTATTTAAAGCAAAGCGCTCGTACTA
AGGCCTTACACAATAGGAGCTCGTGGATACACAAAccccaagaagacgaaggccCCGACAATGGTAATCGCCGATTACCAAGTAAGCAAAGTACGAATAC
AACACGATACACTGTatttgttgctgctccttgctAGAGCTTGTCGACTCTATGATATAAATCACCACCaagctgcgctgcttcgTACGCTGGTGTCGGT
TTAGttggtgctgttgttgcGGATATAGTACGGATTGTCCTGGAACTCCGTCTCGCAGTACGGGAAcagcgtgtcgtcgtccgacggCGTGAACAACTCC
TTGCCGGCGTGGATCATGACGTAGCATCCCGTGACGGCGCACACCACGATCACCAGCATCGACGCACCCTTGTCCAGGAACGACATGCTCTTCCAGAAGA
CACGCAGATAGATGATTAGCGGCAACAGCAGGCAGCTTGTCGTGTGGGCAGTGGCGCCAGTGAAGTCCTCTAGGTCAAGGAagcgcttgcgcagcagcac
agcaatAACCACCAAAATAGCGATGATCGCAATACGAAGTGCAATGTAGCGCAGCGGGTTGCCGCGGTACGGCGCGTGCAGTTCCTCCTCCGTGATCTCC
TCTCCAAActcgagagcgacgcgcaGGTGCGACATACGACCCTCCGACTTCTCAACCATGCTCGAGGCAGACACCTGGCGGTTCACCGTGTCCATGGGCG
TCGAGCTCTGCATGTACGAGCGCTTCTCCTGGGTCTCCAGATCGAGGTCAACGTTTGCCTGGTCCAGCTCACCGTTAAAGGGCACAACCTCTGGGCCCTT
GTGCATGCCAAGGATCATACGCTCCGCCATAAAGAATGGAGGCATCATCAGTGTCGAGAAAGCGATCGAAATGTGCACCTGCATGAACAGGTACGACATC
ACCACGGCGCCACGGTCGGCAGAGAAACCTAGAGGGGCCAGACCGAGAGGGTCGGTAGTGCTCACGATCGAGTACAGGATGTTGCCCGACAGCTGGCAGC
CACCGGCAGTGTAACCAGCCAGAGCCACTgccacgaagaaggccgagatgAACAGGATGGTGATCACCACCACACGCGGCATGCGCTGTGGCTGCGagtg
ctcgcgctgcaagTCGGGCACCACAATAGCGGCACCGTACGCAAGCGCGAGGTTGCCAAAGCACGTTAGCACCTGGTGCAGCGTCACATCGGGAGACGGG
GTTGAGCCGTGGCCGCGCATGTTCCACTGCAAAACCGACACAGCGATGATGTCGGCAATGACCGTACCCATGCAGCCAGCGAACGCCATACCAGCGCTCT
CCTTCAGCGTTGGGATCAGGCAAACCGGAATGAccatgagcgccatgaagatgATCCAGAACGTCTGGCTGAACGAGTCCGGGAACAGCACGTCCAACAG
AgtgctgcccagcaccaggaagGCGCACGGCACCAGCAGACACACGCCCATCTGAGAGACCACCGTGAAGAAGCGGCCCCACTTGCCCAGAGCCCACTCG
CCCAGGTCTCCGTAGGTTCGCACGGATGACGGCGCTACCAGCATCACCTTGGACAGCTTGAGCGTGGCGTACGTGTTGGCGAAAATCATGAAGGCCAGGG
CGATGGACGCGAACAGCGGACCGGCACGCGCGTAGTTGGAAGGCATGGCCAGCGAGCCGATAccgcagacgcagcagaagaggtTGAAGGacgccttggc
gtcctccatggTGAAGAAGGCAGACTTGCCGTTGGCGGTCGACATCGTGGAACGAACGAAGGAAGAAGgtcgagcgccgcgatctgagactgctgctgct
tgctggacTTGACCGCGAGAAGAAAAATTCCAAAGTGAGCGAGTTAAAGCGGCTCGCAAGCGACGCACACGGCTCATGTCATTTTTCTTCTCGGGTCCAC
CGCTGTCGATTTGCCTTTCTCCAATGTgagtgtacatgtactatgCTCAGTGAGAACGGCGGTCGAGCAGAGCCGATGCGTTTGGCGACTCTTTTTCGGA
GCCAACATACTGGGCGCGAGTGTCACGTGCAAAGCGATCACCTGTGTCGGGCCCCAAAACTTGGCATGTCCCTGCTTGCAACAAGTTGCCGATGCAGCAG
AGACTTGCATGGAGGCAAGATACGGAGGACCACATGAAGGCAAAGCTG