Description :
From Genome Similarity Track
Location :
Scaffold_613:270- 3585
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_613-abinit-gene-0.14TRNA wybutosine-synthesizing protein

Sequence
3315 bases(100 bases per row)
AAAAGGCACACAGCGAATGTCGGCCACCAGGTGGTGCACCTTGGGCGCGTACGACTTGACGCGCTCCACGTGCTCGCAGGAGATGGCCCATTTCTTGCCA
AACTGCGCCGCCAACTGCCGCAGCGAGTCCAGCAACCGCTGTTCCCAGGCTTCGCGGTCCTCCACAGCCACGTTGTCGTGCACGTGGAACCAGCCGCCTT
GTGGCTTGAGTACCTGCACAGCGAGCGGCCAGGCCTTGATACTCGTGGGCAGCAGGCCCAGGTTCACACGGTCCGCGACGTCCACGAGGTTGGGGGCCGT
CTCACGATTGTCGCCCAAGTATACTTGGCACTTGTGCGCAACGCCATTGCGCTCGAGGTTGAAGTGCAGCGCGTCCACCGAGTCCGGGTTCCACTCGCAC
GCGTGCACGAATGCCGCGCCGCCATGCACAAGGAACGGCAGTACGTAGTACCCGATGCCGCAGAACAGGTCCACGATTATTTCGTCCTGGCAGCCGATGT
TGGCCATGCGCGCCTTCTCGGTCACGTTGCCTGAGGAGAACATCACGCGCGTGATGTCCCAGCCGTAGACGATGCCGTTCTCGCGCACCTCGACCCAGCC
TGGCGCCTGCTGCGCGCGCGTCGATGTCAGCGCCTGCTGGTTCACGTAGAGCAGGTCCACGTGGCTCTGGCGCTTCTCGCTCGCATCGATGAACGCCTTG
CGCGCCACGCGTGAGAACGGAGGGGACGTGGACGCGCACACCTTGGCCCACATCTCCTGCACAAACGGCGCCTGCCAGTGCTGTGTGAGGAAGGATTCCC
GCGGTACGAGCAAGATGTCGCCCACGAACTCGTACTTGTCCGGCACGGCCGCCTGCACTGCGTACGGGATGCCTTGCTTGACAGCGAAGGCCAGGATCGT
GCTCTGAATCACTTCGTTGCGGTTCAGACCGCTGCTCCTGCCGAACTTGTTGGCGTACGCGTCTTCGTCCACGACGAGCTCGAGAGCGCTCAGCTCGGCC
TTCGATGACAACGCGCTCTTGAACGCACTCGTGACCGGGATCAGGAACGCAGAGCCACCACTGCCATTCTCTCCATCCAGCTGGACCACGTGGACACGAC
GCAACTTGTCGTACACGCCGTTTCTCTCCAGCAGTGTCTTGATTCTCTTCACGTCGAGCTTGGCTGCGAGCACGCCCAGCGGTTCGTCAGTCGGTAAATT
GGAGTCAGCGACGACAATAATCTCACTGGCACTGGACGAGGTGGACGAGGACGCTGGTCTCGACACAATAGCAGTCGTCTTGCCAGACTCGGGCACTGTC
GATCTTCGAGCTAAGATTGTCGTGGCACTGGAGTCAACCACAACGACAGCAGCAGTCTCAGTGACAGGAGGCGAGGATGCGGGTCTCGGGACAGTAATCA
TCGTCTTGGCGAGCGTAATCTCGCATTGGAACGGCGACGAGTAGAACTGGCCAAAGCCAAAGCACTGGAAGCCGCCGCCGAGGAGGTACAGACTGCTGTT
ATGCGGCATCCACGTGCACGTGTGATACGCAAAGGCCGCGTTCGCGTGCTTCACCTCGCCCAGACGCATCCATTGCATCGTCTTTGCGTTCAGCACGAAG
AGCTTCTGCGTCGCGTTGTCGCCGTTCACGAGGGACGACGTCGTCATGCCGCCTGAGATCACCACGTGCTGGTCGCTCACTTCGCACGCGTTGCCGGCGA
TGAGGCTCGCGTCGGGGCCCTCAGCGGCATTGCCAATGTCGCGGCGTTCCCATTCGTTCGCGACTGTGTCGTACACCAGGCAGTACGACTGCTCTCTGTC
GCTGGCGTCACTGGCATTGGCCTTAGCCTCACTGTGAACAGTATCCGCGTCACCGCTGCCAACGCCACCGCGGGACGACGTCATGCCTCCCCAGAAGAGC
AGCTTCGTCTTCTCGACCACGGCGTTCACGTGGTCGAAGCGTGGGAACGCGAACGGGTTGGTTATCTGGCGCCACTGCGGCGGACTCTGGCTCAGGTCGA
GCGCAAAGAGGTCGCCGAACACCGTGATGGCGTCACGCCCACCGTAGACGAACATCGTCGAGCCAACGGCGCAGCTCGAGTGTTTGTACCGCGGCGACGG
GGCGTGGCCGGCAGTTTCCATGCGACTCCAGACGCGCGTGTCCAGGTCGAACGTGTACACGTCGTTGAAGGGCTTGGTCGGGCCCGCGCGGCCGCCAAAG
ACGACCATGTTGTTCGCCACCACCACGGCCGTGTGCTGCATGCGCGCGCAGGGCGCGTTCTCGGCGTTGAGGTCTTCAAAGACGACCTTGAGCGTGTCGT
CGTCCGTTACCGAGAGGATCTTGAGCGCGGCGAGACGGGACGTCGTGCCGGTGGCAGTCGCACCCTGGCCGCCAAACACGGCGATGTGCTTGTCCCCAAA
CGGGACGCTCGTATGGCCAACACGCTTGACTGCGTCGCATGCGAGCTCCTTAAATTGCTCGAGGTCCACTGACGCGACAGTCTCGATACTGACGCTGTCA
ATAGCGACGTGCTGGGCCAGAAATTTTACCTTGAAGGCCTCGAGCAGCTGGTCCGTTTTCTGCTTGTTCGCGACAAACTTGTCGTTCGCAATGCCGACGA
TCCACTTGAGGTAGTGGTCGCTCACGAAGAGCTCCTGGGCCGAGTGCGCGATCGGGATCTCGAGGCCGTTCGCGGTTGTGCGGATCGCGCACATGATCTT
CTTGTTGCCCAGCACGACGCCCGACTCGCGGAAGCCGCACGCAATACCCCACTGCAGGAGCTCCTTGGCGGACTCCAAATCGCGGCACACGACATGCATG
ATGAACGGCTCGTGCTTGATGATCAGCTGAATCGTGACAAGAGCGAGACGAGAGACACATCAGCCACTGCGCAACCCATACAAAAGGCAATAAGGCAGAC
GCACCATGTTGCTCTTGGTCGAGACGGCGTCCGGCGAGCGCAATGCGCCCGAGAGCTGCTCCATCGTGATGGTCGCGTGCTCCGCGAGCAGCCACTTGCC
GCCCTTCGTGATCAGGTTCACTGCCTCCTCGCGCACACCATTGGCTCCAGCATCGCTACCATTAGCAGCAGCAGGCACGCCACAGAAGACAGCAATGCGC
CCCGAGCACGAGCTGCTGGTCACCTGTCGAATCGCCACCAATGAGTCAGTCCACTACGAGGAGCTACGAGGAGCTACACACGCACGTACGTAATTCGGGT
GGTCGTTGATGAGCCGGATGAGGTCGACGATGGGCTCGTCGATGCTGCCCTTGGGGCTCTTGTCCTCCGCCATGCGCAGCTTCCGCAGGCTCTCGCGCTT
GAAATGCGCGAACAT