Description :
From Genome Similarity Track
Location :
Scaffold_1682:270- 2651
Transcript NameFunction/comments
Phymu_g13546lysosomal alpha-mannosidase, putative

Sequence
2381 bases(100 bases per row)
GAGCTTCATGACTATGACGTTTGTGATGAGGTGGAGCAGTTCGTCAACAATGCCAAGATGCGTGGAGGTGCGTCTAAAGGCAACCACGTCTTTATTCCAA
TGGGCTgcgacttccagttcgacaaCTCGCGTCGTTGGTTCAAGAACATGGACAAGTTAATTCACTACGTCAAccaagacggacgagtgAATGTGCTATA
CTCCAACTTGTCTTACTACACGGACTTGAAACGTGAGGAAGGGTCGACCTGGAGTGTCAAGACGGATGATTTCTTCCCCTACGGCTCGGCTAGAGATGAC
TACTGGTCCGGCTTCTTCACGAGTCGACCAACGTTGAAGCGTTTTACCCAAGTGGCCAACACGCTTCTACAACAAGTTCGCCAGCTTGATGCTGTGTACC
AAAGCCACCATTCTAGCCCGCTGGTAGCACTGCAGCGCGCTGTAGGACTTGTGCAGCACCATGACGGTCTCTCTGGGACAGAGAAGCAGAGCGTCGCCGA
CGACTACTCACTGAGACTCAACGATGGTATCATCCAAgctgagaaggagatgaacgAGGTGCTGTTCGTCATCGGAGAGAAGGAGCCTTACCAGTTCTGT
TTGCTGGCCAACACGAGCGTGTGTGACGTGTCGACGCAGAACACAAACTTCGAGGTGCTGGTGCACAATGCGTTGGCTCGAACGAGCGTGCAAACGTTTT
CCATTCCGATCACACACAAATCGGCGGAAGTGACGTTGGTGTCGGGAGACGCCAATGTCCGTGAACAGAATGTGTATGTGGCGTTGCCGGTGCACTCTGA
GACGCAGGTGGCTCCGAACTCGTTTGTATTCAGCGCCGAGTTGAAGCCACTGAGTACGACTCGGTTCTTGGTGAAGCAAAAAGACATGAGCGACGATGTG
CAAGAGGAATACGCCGACGCCGGTGCTGACAGTGTGGAGGGTGATTCGGATAATGACGACGTGGTTGTTCTGGAGAACCAACTGCTGCGAGCGGAGATCA
GCAAGAGAACGGGGTCCATCACGAAActcgccaacaagaagaagaacatccaGATCCCGCTGTCGCTCGATGTGGCGTACTACCAGGCGTTCCAGGGTGA
CGGTCCGAAGTCTGGCGCGTACGTGTTCCGTCCCGACTCGAACAAGACGTACCCCGTAACTGGCAATGGCTCCTCGACGACGTCAATGCCAGCCGTGACG
ATGGTGAATCTGCAGACGGGCAATGCCGCAACCGGTGGCCGCACCAGCATGCCGCGCGTGGCGTTCAAGATCGGCAACTGGGTCACGCTCGAGTACCGCG
TgaacgacgccgacgagttcctggagaTCGAGTGGACCGTCGGTCCTGTCCCCATTAGTGACAAGAAGGGCAAGGAGGTGATCGTGCGCTTCGACGCCGG
CAAAAGCATCGCGTCGGACGCCACGCTTTACACGGACTCGAACGGGCTCGAGTTCATGAAGCGCGTCCGCAACCACCGCGACACGTGGAACTTGACGTTG
CACGACAACCaggaggcggtggcggcCAATTACTTCCCGATCACGACGGGCGCGTACATTAAGGACGCGAAGTACCAGTTGAATGTGGTGACGGACCGCG
CGCAGGGTGCGGCGAGTCTGGTGGACGGTCAGGTGGAGGTGATGGTCCACCGACGTCTACTGGCTGACGACAACAAGGGTGTTGCCGAATACCTGAACGA
AACGGAGACAGTGTACGACTCGACCACGAAGAAGCAAGTGACGAAGGGCCTGACGGTGCgcggcaacttcttcgtcaacgtGGACTCGGCGGAGGACGGC
ATGCGTAGCATCCGCTCGAAGATGGAGTCCCAGTTCTTCCGACCGCTGACGGTGTTCCGCAAGCCGGTTTCgtcggaggtggaggcgaaGGTGCCGTGGC
TGCGTGTGGGCGAATTCCCTGCGAATGTGGGtctgacgacgctgcaggagctgtcGAAGCAGTGTTTGCTGGTCCGTCTGTCGCACCTGTACGCTGTGGA
GGAGCactcgacgctgtcgaaaCCTGTGACGGTGGACTTCTCGACGCTGTTCTCGGTGGAGAACGCGAAGGTGTCGGAGTTGAAGGAGATGGTTCTGACC
GGTACGAAGGAGTTATCtaaagaagctgctggtatggagtggaagacgacggacgaTACGTACGGCTGGTCTCCTCGTTCGCTGCCAGTGAAGGGTACGT
CTGTGACGCTGCAGGCGATTGAGGTGCGTGCATTCCGCGTGTGCTTTGCGAAGGTGTCGGAACTTCCGACACCTTACACCGACTCGGAAGAGGTTGTGGC
GGATGCGGACGCTGATGTGATCGATAGCTgggatgaagaggaggattCGTTCGGTACtgtgctgcaggacctgGCGGAAAT