Description :
From Genome Similarity Track
Location :
Scaffold_1203:270- 1415
Transcript NameFunction/comments
Phymu_g12917hypothetical protein

Sequence
1145 bases(100 bases per row)
GAAGTTTCGTTCGGCTTCAAAGACTGCGTCATCAATTTGGTTTGAGTGGTACACGAAAACGCCTCGACTGTGGGAGGTCTGTGATGATCGACAGTACAAG
TCTCAGTCAAATCAGATTATGGCCTTTATGAAACTGTTCTTACCTCACGGGTTTACCTTTGACCCCCCCGACGACCAGTATGCTGACCGCGTGATGCAAG
CAGGGAATACAGCCCAAACGAACATGAGCGCTTTTCTTCATGCTCACAACATCGAGCGCAAACACGGGTCTGGTCTCCTGAAACAACTCCGCGTACTCTT
GCGCGATGGAGCACTCAAAGAACTTGTATCTGGATTCCGTGCTCGCCTAGCTGTAGGCCAAATCAGAGATTCTGTCCCTGAAGCAACCAATGACATGTTT
TTTAGTGGCGTAGCAATCGTCAATGCATTTCTGCGGGTAGCCATAATTGCTggcgatttcttcttctctattTAAAAACAAGAACTTGAAAATCACAAAA
ATTGTTGTGAGAACCGTTACAAAGATTGTAAATTGTCTAAATGTAGAGGAAGTACAAATCACTTGCCCATTCTCTTATTTGCAGTGTTAGCGGATATGTC
TCTAAGTAAAAAGGAGTTCGAAGAAGCATTAAGTGCATTTATACGTCAGTACTCCCCTCATGTCAGAATCTCAGGAGAAGCTGTACTCTACCTGCGCGCC
GAATACAACGGTGTTCCGTCCCTAGGTAACACGCCGACGGTCTTCTTGTTTTCCGCTTTTGGtgcttgcttcaacttgaaccgCGTCGTCTTTAAGGTTC
TCACGTCCGTCTGTGGTGTGACGCACgtcatcaagacgacgcgGCATCCGCACAGACAACACGTGAGTCCTAGGTAGGTGCACGTGATGCAGTCGGTGAA
GCCTCAACGCCTGCCGTCGAAGCACAAACCACCATCGAAGAGAAGCCATTTGCCGCTGAAGCACCACCCGCGGATGATGAGAAGCCGCCCACcgccgaag
aagccgctAAAGAGAAGATGCTTGACGCTAAAGCACCACCCGTCACTGAAGAGAAGTCGCCCACCGCCGAAGGAGCCGCTGGAGAAAAGCTGCTTGTCGC
TGAAGAGAAGTCGCCCACTACCGAGAAAGCCGCTCGCCGCCAACG