Description :
From Genome Similarity Track
Location :
Scaffold_3119:270- 1323
Sequence
1053 bases(100 bases per row)
CATCGCAATGGCAACGTCACCTCCTACTTCGTTACTGGTTGtaaagctgctgctccagtccAAGCCCCAGCTCGCATCTCTTCATCATATCGTTGAAGCT
ATCACATCGTTCCTGGACACGTCGGTCGAGTTGCCTCTCCACAAGACGTGCAAGTTTGGGTCTCTGGAACTTCTGAGCCGCATACCGGTGACCTGCCACA
AGGCGACGCGTCCTGGTCTGTCCGCTGCCTGCTTCGCTCAGAGAAGTTCTACCAGCAGTTCCAGTTCACGCATTCGCTCGTGGAGGCGGCGAAGCAGAAG
GACCTCGGAATGACGCGATAGCTATTCGAGCGTTTTCCTGCCTGTGACGTTCGACGGGAGGCGGTGGAAGGGGCTGCGAAGGCAGGAGCCCTGGAAATCC
TCCAGTACTTTCACGAAAATGGCAAAAACATGAATTCTTATGATGACGACTAAGGTGATAGCGATGTGGAACAGCGTCACGTTTTCTGGGGGTACGAGGA
TGCCGTTTTGGCCGCTCTTGCTGGATACAATGAAGTCGTCAGGTGGGTTTACAACTTTACTGATAGCCACACGAGGTGCGAGCAGAAAGTGACGCGGACT
GTCATTGAGACTGGGGATGTGGCCTTGATTGAATGGCTCTATCAGAGGCTAGACGCCCCTCCTCATGAATGAATGCTTGGGGCCGCTGCGAATGGGCACG
TTCAAATGCTAGAGTTGCTCGAGTATGAAGGCTGCAGTACGAATCCATTCGCTATCATAGTGAGAGTTGCGGAGGTCGGTCAACTGAATGTTGTGCTTTG
GGCCTTTGAGAGTATCCGCAACTGTCTATCTCAACAGAGTTGGGAAACAGGCCTTACCGTTCACACTGCTGTGGTTAATGGACACCTGGAGGTGGCAAAG
TACATTTACGCGTGCAtcgacgatgaggacgaaTCGCAAGACAAAGAAAACCTTACTGCCTGGAAGAAAGCCGTGACGAGCGTGCTTGGGTCAGAAAGCA
ACTGTGCTGCCATTTCAAGGAAGACCGTGATTCTAGCCGCAGAGGGAGGCTTT