Description :
From Genome Similarity Track
Location :
Scaffold_12:27- 8030
Sequence
8003 bases(100 bases per row)
ATTGGCTGAAAGCAGCATCTTTTAGCCAATGAGCGACATGCATAGCGTAGGAATGCTGCCAACCAGTCGTTGGCAGATTCCCAACTTAGAATATTACATT
TAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGACCC
GAGTATATTTAACTCTAAGTTAAACTAGGCTACGCTTCCTCACATACACGCGTACACGTGTAAGCTAGAGTAGTGAGCCAAGGTAGGCCCATTACACCTG
GTAGCACTTTGTAGTCCGTCCAACGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCAGAGCTAAGAACCTTCCCATGGATAAGGAGGTGTCCAT
GAAAAGCTCCACTACGCCTGCAACTCACGTTGCACGGGCTGACTGTCCCCTCTGTCGGACCCAGAGTGGGAAGCTCTCCAACGACTGTTAACAGTCATTG
GTGAGGCGGCTGTAGCTACGATGCTGCGTACGCCAACGCCGACAGAGCAACATGGTGTTGCTCTGGGATTCATCATGAGGGAGCAGCGAGATGCTGCTTC
GTTTACCACGGTGTCGTCGGGGACGGCACCGCGCGCGCAATCGCTGAAGCTCAGCGTGAGCAATTACGTTGGAAGAGAGGGCGAGCCTCTCCTCCGTTGG
CTTGTCGAACTCGACACTGCCATTGCGGCTCGACGCATCGTCGACCCGTTATTGAAAGTCGCGTTCGCCAGGTCATGTCTTGGCGGACGTGCAAGAAGTT
GGGCGTATGAACGCCGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCACGGAAGAGCTCAGACAAGCGTTTGAGCCCCCGCAAAACGAGTT
CCGGTCGAGGGCGGAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAAT
CCGATCGACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGACTGAGAGATGGGCCTGTGAAGACCTATCGCTTCCGTGAGTACCCGAGTACTCTCGAAG
CTGCAATCACTCTTGCAATGCAGGAGGAGTTAAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGG
AGGCCCAGAACCCATGGACCTCTCGAGTGCTGCAACTGCCGGGCCCCAGCAGTTGCAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGGTAAC
TTTGTTCGGGAGTGCACAGCCCTCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGTAGG
CGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAGTCCCCAGTGAGGTTCATTCTCGGTGCAAGAAC
CAAGATGACAAGCCTGACCTCGTCATCCTGAACGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTG
TTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCATCGTAAAGACCCA
GAAGCGCATGGTACGCGTGCGCTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGC
ACGCCGTGGCTTGCACGGCAAGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTG
CCGCTACGCACGCACCGACAGGTGCGCGCGACTCCCCACTCGAGACAGCGTCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACGCGCGCA
AGAGCAGCAAGCGTCGGCGTCGCCGCCGACGGCTGAAGGAGAAAATGTGTTGATCTCGGATATCAACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCG
ACCTCAAGGGGCACAGATGACGCAGACGAGTCACACGCCTCAGCAGTGGAGGCTGACGCGAATCTGATTGGATCAGGTCTGGCCAATAATAAGAGCGAAG
GTGACGTAACGCCGTCGACTCCGGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCTGTAATGGGGGTCTCCGCCAA
TGGTTGGCGTCGAGGTAAGGATGGCGTGTCGACTCCGGGAGTCGACGCTGCAAGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAAAAAACTTGCAT
GCTGTCGTGCACGACGAAGCGCCGGGCGACAAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATAAACCCGCCGGTGGTACTGAAGAAGAACACCCGTCCA
CGGCTGGGCCTGGGCGAGGTCAAGAACCAAGCGGAGCCGGGCTCCCCAAAACAAGAAGACGGCGCATGCGATGGTCGCTGCGCAAGTCTCGGTCTGGGGC
CGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCAAGACGTTCAACGTCTTGACGCGTATCTGTGCCGGGTTCCGGTAC
AGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTAATGAACTGGAAGCGCTTCGCGCGTGACTTGCACGATGGAC
GCATCGAGCAAATATGCGTTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGCTCTTCATGGAGAGCACCACTGAGCGTGAGGA
CACTCTCAGTGCGAAGACTAAGAAGGAACGCTTTGAGGAGCAGAGCTGGGACTCGCTGAAGTCGAGTCCCTTCTACGAGATTCTACGGGAGCACGCGGAC
GTGCTTCCGGAAGAGATCCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCATT
GACCACTGCCGCGAGAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAGTCGAAGTCCCCGCACAGTGCTCC
GACGTTCTGTGCCAAGAAGCCACAGCGCGGTTGGCGCATCGTTCATGCATACAACAAGCTGAACGATGCGACGATACCGGCGCAGACGCCGATACCTCGA
AAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCATGATCTGCGCGATGGATTCTATCAGATCCTCATGCGTGAGAGCGATATCC
CTCTCACGGCTGTGAGCACGCCGAGCGGCATACTCTGGGAGTGGCTGGTGATGCCGCAGGGGCCGAAGAACGCCCCTCCGACCTTCAACAGGTGCGTGAC
GCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCAGACGGGATGAGTGATGTTGAGATGCGC
AAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGTGCAAGCAAAAGCTCTATGCAAACCTGAAGAAGTGCATCTTCGGGGTGAGCGAGATACCCGTGCTCG
GGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGGAGGTCAGAGTGATCAATTAGTGGCTGACGCCGTCGAACGTCAAGGAGCTGCGGCAGTT
CCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGATTTGG
ACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGATGCCGACCAAGATCGCCCATTCCACGTTGTGT
GTCACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGCCTTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGC
TGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGAGGTC
TATACGGACCACGCGTCGCTGCGGACGGCTGTGAAGTCGCCGCATATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGTAGAGTATAACTTCCGGG
TTGAGTATAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCAT
GCGATCGAGCACCCCAATGTCGTCACTGTTGGAGGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTATGGCTCAGCACCT
TCTGACAATGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTACCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACA
ACGCGGACCGCGTTGTCGTGCCCACCTGCGACTCAGGATCATGTATGAATATCACGATGCACCGACTGCGGGGCATTCGGGCCGTGAGAAAACATACTTT
CTTCTCACGCGGGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTCTG
CGCGGGCTCCCTTGCAGTCACTGCCGACTCCGTCGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACAC
GGGCGTTGTGGTCTTTGCTGACCGCTTCAGCAAGATGTACCATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCTCGTCTGTTCGTTGAC
ATGGTGCTCAAACACCATGGCATGCCAATCGACATTGTGTCGGATCGAGACCCGCGCTTTACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGA
GTCAACTTTCGATGTCAACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTACGAGGTACGCTCACTC
GTTCCAACACTGGAGCGACTGCCTGCCGATGGCGGAGTTCGCCATCAACAACTCCGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATC
AGGCACCCACGCCTCCCGAGTCTACTCAGGATGGTGGCTCTTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCACTGACA
CTTGCACAGTGTCAGCCGCGACCACGCGCAAGAAGAAGAAGCACGCGTCTGTGCAGGGCACAGACGCCGACATGAGCAAGAAGAAGAAGAAGAACGGGTC
TGTGCAGAACACAGACACCGTGAAGACGAACGCAGAGGCCGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAACTTCGTGCAG
CGCAGACAAGCTGTCATTCGGTTTGTCCAAGACGCTATCGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGTAGGGGCAACACTAATG
AATTCAAGAAAGGTTCATTGGTTTTGTTAGCAACTCAAAACCTGCCTAAACATGCAGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGG
GCCGTTCACAGTGTTGGCACAACATGGCAACGCCTACATGCTAGATATTCCATCTAGCATGCGCCTCCGTCCAACCTTTTACGTCAGGCGGCTGAAGCCA
TACTGGCAGCACGAGCCACCTAGCTCGGCTGGCCCGAAGCGGAAGCCCCAGCGGAAGCGAACCTCTGCTCCAGCGCGTGAACACGTTGGGACGAGCGCAC
GACGCGACCTCCCACGTCGATAGAGATGTCCGACGCGCTCTGCGAGGCCTGATCAACTTGAGCTGTCAGGGTCGCCATCTCCTGCTTCAGAGCGGCGAAC
TCACGGCTCTGAAGCTGCTCCACAGCAGCGACTCGCTCCTCGAGGGTCGGGCCAAGGTCAATCCCAGGTTGATCATACCCGGGGCGTGTTCCCACCACCG
CCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGGACCATAGTATCCCGAAAACGAACCGGCAACCGGTTCGTTATC
GTATTCGTTGGAGAGGATTTCCGCCCCACCAAGATACATGGGAGCCACGGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGCTCA
CCACGCGCTGCCGACGCGAAGGTAGTGCGAGCGCTGTGGTCACCTACAGCGCCCGAGGTCCCACGATCGTCGCGTTCCTCGCGTGCCAAGAACTTGGCAC
GGAGATCCTTGAGACTCTCAGGTACACGAATCGTCGTGTACCCGTTTAGGTCGCGGTCGCTCAAGCGCACCCGCACCCGGAAGACACAACGTGCACTGAT
GGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGTGGAGCTGCTCCAGCCTCCCGCGCGTCGAGAATGTCTCGAAGCGCTCACGGGC
ATGCTTAACCCGCTCACGGTAAGCAGCCGGCTTCTTGTTGAAGTTCTCAACGAAAGCATTCCAACTTTGACAAAGTGCCTGCCACTCAGGCACTTTGCTG
CGAGAAGAGGTATTCTTGCTGGAGAAGTATCGGAGCTCCTGAAAGAGTCCGATATAGTAATCGCGCCTTTGATTCGTTAACGGATCAAAGTGCTGCTCCT
CCGCCACAGCATCATCGTGGATCCCGCTGCATACCTACAGCGGGATTTCAGTTGGAGGCACGGTGTTGCCCACACGGTCTGCGATCTATGACGCAGATAG
CATCCACGGATCGCGCGCTGCCTGAGCAGCGCGCGGAGAACTTGAAGACCCACCTCACGCGGGGAGCTTAAAGCCCCAGCAGCGGAGAGCGGAGTGTCGC
TTTCGCCGCGCGAACGCTTCGAGCTTGAAGCGTCCGAATCGTCTCCTTCACGAGGGCGTTTGACCCGGTATGCGAGTCGAGACTATCACTGTCGATAGAC
TCTTTGCGCTTGTTGGAAGAGGCCTCGCCCTCTTCCATCTCCACGTCATCATCCCCGTAGTCAACGGCGTCGTTGACTACAGAGGAACCTTCGAGGACAA
TCTCCGACTGGGTTGTCCCCGACGCGGCCTTTGCCGCGAGCGCATCGCGCTTTGCCTGCTGGCGCTCATGGTACTGAGCAACAGAGAGCTTACCCTCTGT
TGGGGCGGCGGTCTTCTTCTGAGACGAGCTCATTGCGGAATGAGCTCGAGTTTTCTTTCTCCCAATATGAAAAATTGACGAATGGTCAATTTCCCGATTG
ACGTGCCGTGTCTCGGCGCGTCTAACCTTGACGGGGGGATGGTGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTAACTCTAACAGTCACGAC
GTCTGTTAGAGGTTCGAAAGACTTTCTCGACTTTGGTGTAGACACACCAAAGGCTGCATACATTTACGATCACCACGAGGGGTGGTTCATAGAGACTTAG
GATTCCTATTGGCTGAAAGCAGCATCTTTTAGCCAATGAGCGACATGCATAGCGTAGGAATGCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATA
TTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCG
GAGACCCGAGTATATTTAACTCTAAGTTAAACTAGGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGAGCAAAAGTAGGCCCATT
ACA