Description :
From Genome Similarity Track
Location :
Scaffold_1907:27- 4413
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_1907-abinit-gene-0.5ATPase
Pytul_var.sporangiiferummaker-pug3_contig_1907-snap-gene-0.4Conserved gene of unknown function

Sequence
4386 bases(100 bases per row)
TGTCCTCCGTTTGTGGACCAAGAAGCGATCCTGGGGCGCTTTCTATTGAATTTACAGAAGAACCCGAGCACAAGGCAATCGGTTGAGGTGTTTCCAGTGC
CACTCGATAAAGCGGAGCAGAAATCGATCGTCGAGAACTATGACCAGCCGTCGGTAACGTATTTGTACGTGAATGGGAAAGGATCCTTCCAATTCGTGCG
CGACAAGAGCATGCAGCCAAACCAGGGAACCACATTCGTGTTTTACAAAGACGAGTACCTCACGGGCAGCGAGGTGAATGCGATTGTCGAAGCGTACAAG
GAGATCTACTCGTACCCGCACGTGCATGCGTTTTTCCGACATGATATGTCCCAATCACGACGCAAGATTCTTGCGGATCGGAGTGGCCCAAGGCGTCCGG
ACGCGAATAATCCAGTTGCGACCAAGGTAGGACGCAGTGGGCTTTGTGCTGCATTTCGTACGCATGTGTTCTCATTGTTACTCCTATGCATATGGACATT
GTGAGCAGGACGAGGCGATTCAGCAGCTCCAGCAGCTTGGCATCGACGTGTTTGAAGCTGCGGAAGGAGAGAACACAGTCAACTGGGATAGTTTGGTAAG
CTTCAAGCAGCTTTCATAGAGAGAAGTCATATTGATGTTCACGTCAATTCTGATTGCCTGTGTTTTCTTTCCTGCTTCCTTGATCGTTTAGGCTGGATAC
GATAGAGTGAAGCTCGAGATTGAAGACACTGTTGTGCTTGCGCTGCAGAACCCAGAGCTCTATGAAGACATTGCACGAAAGACCCGCTGCCGATACGAAA
GCAACCGACCGCGTGCCGTGCTGTTTGAAGGTCCTCCTGGCACTGGAAAGACGCTGAGCGCGCGAATCATCGCGCAACAAGCGGGCATTCCGATGATCCA
CATTCCGATTGAAAGCGTCGTCTCCAAATGGTACGGCGACAGCGAAAAGAAGATGTCGGCGATCTTTGATGCCTGTGAAAAACTGGATGGCGCGATCATC
TTTATCGATGAGGTCAGTGGGTGTTTATGCAGTTCTTTATTCTTGCATGATAGCCACATAGTTGACATTGTGCATGATGAATGGTGTGTGAATAGATCGA
TGCACTGGCTGGGGACCGATCTGGAGGGCAGATGCATGAAGCCTCGCGTCGCATTTTGTCTGTGCTGCTTCAAAAAGTCGAAGGGTTCTCTTCGGCCAAG
AAAACGACGGTCGTTTGCGCAACAAACAGGTACGTTGTGCGTTGCACAGAGTATACTTGAGCGAGCTGCACATTAACAATGAGTTGCTGTGATCTGCAGG
AAGCAAGACTTGGATTCTGCTTTGATCAGCCGCTTTGATCTTTGCATTCGATATGACCTGCCGGACGAAGCCACCCGTCAAGCAGTCTTTGGACGGTAAG
TAGAAGTTTCACCCCGCGTATTGAGTTGAGGTAGCTGACTGACAGATACTCGCACTTGTAGATACGCGAAACAACTGTCCTCCGAGGATTTGCATCAGCT
AGCGGTGATTTCTTCGGGCCTTTCGTGCCGTGATATCAAAGAGGTAGGTTAACCTTTCAACCTGAACGAGAAGAGTCTTGTTCATTGACATACTCATGAT
TTTTCTTTGCTCAGATTTGCGAATATGCCGAACGAAAATGGGCTTCGAAAGTGCTCAAGAAAGAAGAAACAGAAGAGGTCCCAACTCTTCAAGCATACAT
GGAAGCAACGAAGATCCATACCCTTGGGATCAACCAACATGGGTCGCAATCGAATGTTTATGAAGCGTGATTTGATCCGCATGTAGTTGTAGCTTGCTGT
GATTAGTGCGATCAAATTAAACTTTTCAGTTTTTCCCGGGTAGTTTTTGTGCCACCGAGGTTAAAAAGTGCTGGTATTGAAGTTGCAGATCCGGTCTCAA
TCGTTTTGCAAGCTCATCGCATTTCTCTACGAAAACAGGTTTTGTTAGTGTATCATCAGAAGCTCATGCCAACGCACATCTATCTGCGTACCAAGAATAC
TCATCGATACGTTCATGAACTTTCTGGCTTCGTCAAATGCTTCATTCCGATGAAACAAAATTCCCTGGCATTGCAGATGGATGTCAGTCACTCGACATCT
TTGTATACCAAAGCAAAATGCACATGTTGCTCACAATGTTCCATGCTTTGGCCACCAGCCACTCCATGTCATCTTCTGGTATGGTGACATCCAAGCTACC
AGCAAGCTGAACGAACTGTTCAAGCCATTCGAATGCGATGGACTTTGATTCAGCGAGGGTTATGAGCCGCCGGAACAAATAGCACAGTTTCTCTGGGTGA
ATCGTGTCGCCTTGCAGCATAATTTGAAGCCTATCAGCTAGGAGTTAGCACAACCAAAATTTCTTTATCCTAATATTCGCTTGAGCAATGGTGAATTACC
CATATTTAAACAGATTGCTTGCGAGTTGCTTGTATTTCCCCCTGACCTGATATAAGCCAAGTAAGAAAACCCCGCGAATGCGAATGCCAACTAGATGGAA
TGACAAACCTCAGATGCCTCATCAAACTTCGCCGCATATAAAGTAAACTCTAAACTCACGTAATGCTGAACGTGTGAGAACGATGCTGTGTTCATACCGC
ATGACAGACAGCTAGATAGGTGCAAATGAGTACCTGCAAGATGAGCAAATTCGTCGGCATGTCTTCGCATTTTTGCTTGGCAGAGGTTGAATATCCCATC
AATGTTTGGATCGAAGAGTCGCAACTTGATTGCAAACACACATTTTGCCTGTGGGAAGCGAAAGTATGAGAGGAGGGGCATTGCAAGGTGAGGTTAGCAA
GGCCATCAAGGATCGCCGTACCAGGTATTCGACTTCACTATCTGAAGGCGACTCCTCATTTCCGAGACAGGCTTCGCACTGGTCAACAATCTCAAGCAGT
TTATGCAGCTGATGTTTGTCGAGGCGTTCCAAGTTTTTCATATCGCACGCAACAGCAGCCAGCAGGCATTGATGTTGACGCTGGTGCAAGAGGGAATTCT
CTTGAAGCACATTGTCCGACACTTTTGCGATTTCTGCTGCCAGAACAAACATATCACCGGAGTCTGCATTTTTTGCAATATTGAAACTGGAACAGTGTTA
GAATGTGGCTATCATGTACGTGTGCGATCACGCATTCGTACCTCATTGCATAAAACCACTCATACACCGCTGAGGAGTGTGCTGCAGTTTGTGATGTGTG
CTTTGGCAACTCGAGCAGCATGCGGGCGTAGCTCTCAAACTTTTTCGCAAACGGTGAGCCAGCTCGTAATGAATCATTTGCAGCTGAGCTCGCTTGAGCT
GAACAAGTGTACGCGAGCTGCGCTGTGTTTTGAAGCAAGATGACAATGGGAACCGCAAATGCATCTTCCGGGCTTCGAAGCGCAAGAGTACACAACTCGT
CCAGTATCTCCAACACTGCTGTCTGTTTTGCTGGACCGGCACTTTGAGCTACTTTTCCGAGTGCAAGTAGATCTTGAGCCTCAAAATCGTCTCTGTCCTT
CAGTCGCTGTATGATACTTTTAATGCTATCATTTGACTGGGGTTCCATAAACTCCACTTCTGCTTTGAACACGGAGAACAGTGACTTTTTAGATGGGTCT
GTGGCAAAAGCTCGATTTGCCCATTCGAGTGCGTCTCCTTTTTGATCCAGCCGCAGGTAGCACAAAGACAGTATTCTACACAACGAAAACAGTTTGTTGA
AGCTTGCTCCAGGACTCCCAATTCCTCAGTGGATACAAACACAAACCTCATGTATATGCCGGTCTCATGCTCAGTTAAAGAAATGTCGATGCCCAGTTTC
GCCCATTTCATACAATCCTGTTTATTCACACTTTTTTCAGTACAAAATGTACTTCAAAGTGATGGTGAAACTAAATATTGAGCTCAATTTACCTCGTAAG
CGTTGAGGTTCAAATGGTGCTGTGTTGCATCAAGCACAGTTTGATGTATCCGCTCAACGTGCTTTGAGAAAGCATTATTGCCTTCATTTCTGCGCAATCA
AAAATATATTGCCGGTTAGACACGGTCAATATCTGTGCAAAAATGCTCACTGTACCTTTCGTTTTCCTTGATATGGGTGGCGACTCTCTTCAGCTCGCTT
ATCGACCGCTCTCTCTTTTCGGGAATCTCGGAGAAAGCTAGACTGCATGCAAGATCGAGGTTGATCTCAAGTTTGTTTTCTCCGTAGTTTCGCTCCAGCT
CTTGATAAATCTTCATTGAATTGTCATCGTACGACTGCGCTTGAGCATAAAGTCGAGCTCCTTGTCTCGAATACTCGAGATTGTCTAGCTGAAACAAGAT
CTTGAGATAGTAGGCAGCTTTGTCGTATTGCTGCGCTTCTATGTAAATCTTCGCCATGATAAAAACGGCCGCAGAGTCGCGACTTT