Description :
From Genome Similarity Track
Location :
Scaffold_296:27- 22016
Transcript NameFunction/comments
g15830.t1hypothetical protein
g15831.t1hypothetical protein
g15832.t1hypothetical protein

Sequence
21989 bases(100 bases per row)
CGGTATATGCATTCTTCGAAAGCTTGGGCCACCATGAGAGCGAACGTGTCCGACATAGCTTTGGCAACCACGAATCCAGTGAACGAGCACTGGAACAGTA
GTAGCGCAGTGTTACCGCGTCGAGACTTCGGCAAGGGTATGATGAAGTCCATTGACACGATCTGGAATGGTCGTTCGGCTAGGATATTGCCTGGAGAGTA
TCCTCGAAGCTGTGGACGGCTCTTACTGGAACTGCAATCCAGGCACGACTTCACGTGCTTCTCCACATCAGCGTACAAACCTAGCCAATAATAGTCCAAC
TTTACTCGCTGGTATGTCCTGACCACGCCTTGGTGGCCGCCTTCCAGCGAGTCATGGCAGTTCTGCAAGACTTCTTGAATCATCGTTGTTGGTACTACGA
GGCGCAGCTTGGTCTCTGCTTGCTGGTTATCACTTCGCCGACGACTTACTCCTAAGTAGTACAGCAACCCATCCTTCGTTAACACAAACTTGTTGGCAAT
CTTCCAGGCATTTCGAGCTGCCTTGTAGCCAATATTTTCCAAGTTTCCGCGCAGTACCGATTTCAGGTTGGACCACCTCACTTCCTCGTCTTGGGCTCTG
GAAATACGGCTTCGCCGCTCTTCCTGTACTGCCACTGGGTCGATGTCATCTGCGTTTACCGTCAGTGATTGCTCAGGTCTGGGTTGTTCATTCAGCGTAT
TCTTGGTGGGTGCCCCTGTAGCATTTGTCCGCTCCGTCGGCTCAGTGAGTTGCTCAGAGGCGACTTCATCTGCGAACCTAACACGTTTTGCTGCGCTGTC
GTCTTGTCATCACCGAGACCTCGCCTAGCTCTAGTCGTACAAAATCGACGAATGTTTTGCGTGTCGACCTCATTTGGGCGTCCAAGACTTGAACGAAATT
ATCAGGACTCGGCGTAACCACATTGATGCTCTCCGGCGGGGCTTCGTAGATCCTTTCGGGAATCCTGTTCAAGCTTGAAGCTCGGCTTGCCTGTCTTTGC
TGAGAACCACCTTCGATACCTTCATCTCTAGTGTTTCGCCTGCTAACGAGTCTGCCGCTGCATTTTACTCTCTCAACACATGCAGATACTTTATGGACCG
AAGTTTCGCTGTAAGTACTTTGTGGCGATTCAATAATGCCATCAGCGACTCCTTCCTGCATGCGATCACCCCTAGGGATTGCTGGATTGCGATTCTCGAG
TCTCCGACCACGGTCAAGTCCTCGGCACCGTGATCTAACGCAGCTTGTACTCCGTTGTTCATGCCTGTGTATTCCGCAACATTTACCGTGGTGCTCTCGA
GATACGCACTCGCGGCGATCACTATCTTCCACTCAGGGAGTCGCCACACAATCCACGAACAGCTACCGTATCCGCCGTACTTTTCCGTCTTCGCTGATCC
ATCAAAAGACACCACGAGTCCTCGGTAGTCGCGAGGGAGACGTGCATAAAGGAGTTCAGGGTCCATTCGAACTGTAGGCGAGCCTTTCGTTGGTGGTGCT
ACGAGTGCTAGCGATTCTTCGAGGTCGACAAAGTTCGTTATCGTCGACTGTAGGAGCTGGGCAAACACACAGTCTTTTTCTTTGACTCGTTGCACTTTCA
GGTGCCATGGTGATAGCAACACCGAGAACTGTACTGCTCGTCCAAAGAGTGACTTTGATCGGTGTACCCAGTCGAGTGTCAAAAATCGTGTATATACGTG
AAGTGTCTGTCCGGCCAACTGAGTGTGACACATCTTCAGCAACAGCAACAATGCCAGGACCTCTTTTTCCGCCGGGAGATAGTTCATCTCGGCTTCCTTC
AAAACTCGTCCACAGAACCGTACGGGGTGCAGCTTGCCTTCGTGCTCCTGCATTAGCGTGGTACTTAACGCCCACTCATTTGCGAATAACATGACATGAA
CCGACTTGGATCGGTCAAAATGTCGGAGGATCGGCGCATCCGCCACCTTCTGCTTGAGCGCGGCAAAACTTCGTTTCGCTGTTGACAAGTCACCTCCGGA
TTCAAAGTCTGTATCTTTGAGCTGATACAGTGTAGCACCGTATACGGCAAAATCTTGGATGAATCGACTATAGTAGTTCAACGCACCCAAGAAGGATTGC
ATTCCATTCTTGGATCTCGGGAACGAGAGTTCGGTAATCGCAGCTAGCTTCTTCGGATCTGCTTGGATGCCGGCAGGTGACACCGCATGCGACAGAAAGT
CCACTTTCGACTGAACGAAGATGCTTTTCGTGAAACTGACGCTCATTCGACACTCGACAAACCGACTTAGTAGACGGTCCAATGTCGCCAGACAGTCGTC
AAACGTTGCTCCGCCGAAGCAGATATCATCCACGAAAGATCGCCGATCAAACACCGGGACCAATACAGACTCGTCGGGTTCACCGTTCGGAAACATGTCA
TCTATTGGGCTGTTCACGAGTTGTGCCACTGGGTCCATGGTTGACGAGGCTTCGTGGTCAGCGTCAAACTTCGTCCGAGGGCTCGGTTCAGGTGCTGACA
GCTTGAGTGATTCTTCGTTGTTGGTTCCTCGTAACAGCGTGGCCTGTTCCTCGGCTGCATGCATCAGTTTCGCGTAATGATTCCACCCACCTTTTGGTTG
GACAAATCCCCACAACGCGTTGTCTATCATTCGTTGGTAGATCATTGGCGCGTTCTTGAGGCCGAATGGCATTCGAAGCCATCCAAAGTGCCTCAGTGTA
CAGACAAATGCTGAGATCTTTCGCGCTCGATGAGTCATCATTATCGCCCAGAATCCGCTGGCCGCATCGAGCGAGCAGAACCATAGGTAGCTTTCTAGAC
CCTTCAGCAGATCATCGACGAGTGGCATCGCGTATTCCAAGATCGTTGTGACGGCGTTCACCATCTTGTAATCAATGCACAGCCGAATATCCACGCCGTT
CTTTTTCAGCACTATCACAATTGGCGACGCCCACGGGCTATCCGAGAACAACACCAATCCAGCTTTGAGCAGCCCTTTCAGAAGCTCATATAGCTTTGGC
ATGTGTCGAAGCGCTACTCGTCGGGCACGCTGTTTGATAGGAGCGTGCCCCTTGACATCAATATCGCAAACCACTCCATAAGCTGGTGGGGGAAGCGCGT
TACCACTCGAAATCATGATTTGCTCGTGTTTCTTGAGCACATTGATTAGTCGCTTCTGTTGCCCACCCTTGAACTCGACGTTTTGTACATTTGGCGCCGA
ATAGTCCAGTATCGTGACCGAGGTCTCGGTCAGGTCCGGAAGGAAGGCAAGTTCTTGCGCATAGTCTTCAAGTTCAATGTGGTTGGCTTGGTGTTCAGCC
GAGTCCCTTGCTTCATCGACGTTCATGGTTTCATGTCCTTCGGTGTTTAGAACCCTCATTACCGCCATGAATGTCTTCTCGAGCACCGTCGCCGGGTTCT
TATCTATTTTGTTCCCCTTGGGCGGCGGTTCCTCTTTATTGACTTCGCCAACTGCGGATTCTCTGGTGTTGAACGATGTCTTGGTGGTCACCCCTGGTGG
TACGTCTCCGCTAACCGTGATCTTGGCAGACGGTGCGATCGGTATAGATTCTGGATCATTGCCCACTGGCAAGCCATCAGTTTCGTTGGCCGATATCTCG
TCGTCGCGTTGTTGCAGGAGTCGTTCCCAGCGCTGGGCGCACGTGAGATGCTCGCCTTCATCACTGAAATAGTCAGGTGGCCGGCTTCGCACTCCTCGGG
GTGGTGTATAATCGACTTTCTCCACTGCCGGAGGTTGTTTGGCGAGCCATTCTTGGTAGAACGTGGCTTCTTTCTCGTACAGAGTTTGATCCCGTGATTC
AGCATAAGCAATCACTTGCCATTCCTGGTACTTCCTTGAATCGAGTCGAACGTAGCCTGCTTCGACCGGCAAGTCACCATGTGGTACCCACATCACAAAG
GGCAAGTGAATCGGACAAAACACCAAGTTATCGGTGATATTCGTCAATCGAACTCGCTCCGGGTGACCACGTCGAAACCTCGTCACAGTCGGCACCAAGC
AGTCCGTTCGTCGGATCCATACAGCATGTGTATCCAGCGTTGGTTTCCGTTTTTGTAGCCGGAATTCTCCCCATTCGTGTCCAGGTATCTGTAAAAGCTC
GGTAGGACCACCGAAGACATGCCTACGCCCGGGATTATCGTCGTCCATCATGTTTTTCGTCTTGATCAATGGGATCCTGACCTCGTCCGGGAGTTGTACA
GTGGCATGAAATAGGTCGAGGCGAATTCCGGCTGGGATCATAAAATCAGTGCCAAGCACCACATCAACTCCAGCACTGTGATCCATAATCCACACCTCGA
ACTCGTACACGCGCTCCCAGCCGAGGGTCACCTTGACGAGTGCTCGGCGTGTGGTCGCTATCTTTCCTTTCTGTATTCCTTGTATTTCCAGCCGTCGACC
GTTGTCTGGATCGGTCCTCATCTTCAGCTTCTTTGCCATCTTCGTTGTAATGACACTCACATTTGCCCCAGTGTCGAGCAGTATCCGCATTCGTGTGTCG
TTTACCGCTCCCATAACCAGAGCTCTCATCATCACTCTTCGGTCGAACTTCTGCGACGACCACCACCCCAGTCGTTCTCCAGGCAGCAATCTCACCGTCT
TGGCGAGTACTCGAGGTAACTTTTCCTCAGCCACCGCACTCGAAACCCAGGCTTCGCATTCACTCGACCCGCTTTCTTCATCTTCACTCACATCGCCTCC
ACCGAGGTTTAAAACTCTCTCCTTTTCATTGTCAGTCCATTTCACTCCATCTCCGTCGTCATTATTCGGCCATTCGCACTTGCCCACGTACGCGTAGATA
CAATCTGCGTCGAGCGCGGGTTCGGCTAACTGTAGCAGCCCGTTAGGGACCAACCCAGGTTCAGTTGGCGGGCTGCCTAGTTTAAATGCCCAAATACGAG
GGTCTGGAGCTCGGGCGAGAGGTCCTTCTTGTCAACCTTGTTCTTGACGAGGTTTGCGAGTTCTTGGAAAGCTTTGCACTTGCTCGCATAGTTTGCAGCG
CTTGTAACAATAGTGCGCAGAGTGAGTGAGACCACCGCAGGCAGCGCACGGGCCATACTGACGGCCGCTGTCGCGTCGGTCTCGACCACGAAAACGGTCA
CCGCGGTCTCCGCCGCGCTTAGGTCGGTCACCCCTTGGTGGGCGATTGTCAGTCCGGCCATAGGTGCCCTCAGCAGCAGTTCGTCGTTCGCCTTCATTAG
CCGCAGCGAGGTGTCGTTCATCATCTTCTGAAACGTATCCATCGCTTCTTTCGTCATCGTAGTATTCCGACTCAGAAAAGTGTTCGTCATCGCTGTACTC
ATCTCGACGTGAACCGGAATGGTCGGTGTAGTCTGCATTCGGATCCCGGAATTGCATCTCAGCTATGAGTTCTGTCAACGTGGCTTCGGCCAACATCATT
CGTGGCAGATTGCGATAGTCGTCGCGTCGACGCTCGTTATCGCGGTCGCGTCTGTCCCGGCGGTACCCATCCCGAGGATTGTCAGTGCGCCGGTCGTCAC
GTCGTCGAGAGTTGTCGCGGCCTCGTGGCAGGTCGCGACCCCGATGTGTGGACTGTGATGTCTCCTTAGAGGAGCCACGATCTTCCATCTTCAAGATCTC
GTTGATCATCCGTTCCAAGTCATGGATGTCGCTCACCTGCAAGTGTCCAAGACGGTTTTGGAGGCTCTTGTCTCCACACGTCTTTAAGAATCGTCGAACG
TGGTCACGCGCTTCCCGTCCGCCGTTCGCAAATCGAACATCGGCGTTCCTTGCATAACCGTTGAGTCGGTTCAAGTAATCACAGATGTGTTCTTTGTCCT
TCCGTTCCGCTGAATAGTACCGAATCTTGGCCGACTCGTTAAACTGCGAGCAATAGTACTCGATGAACTCTGCATTGAGCAGCTGCCAGTCGCGCCGAGT
CCTCCTTGGGAGTTGACGGTACCAATGAAGGGCTCCGTCCCGGAGGCTCAGTTCAAAAGCCATGCACCACTCATTAGGCGGGGTATGCGTCCCTTTCATC
TCATAGACGAAGGCTCGTAGCCACTGCATTGAATTTTCTTGCTTGTCGCGGAATCCGAGGTACGGCTTGATCTGAGCGAGGGGTCGATGCGTTGCAATCT
CGAGTTTCGGTGTAGCATTCAAACTTTCCATATCGCTTGCTTCACGCATCTGGCGCGCAAATTCAGCAGCTAAGTTGTCACCATCCCCATTAAAATCCAG
CAGGTCACGTCCGTCGTCCGATGAGTCATCGTTGCCGGACAGTTTCCACCCAGGACGTCGTCCAGATCCTCGTTTCGAGTTCCGCGCTGGGTTTAAGTTA
TCGGTATCACGCGCTAGCCGCGCAGATCGATTAGTCGAACGAGGTGTCACCATGTGCGAGTCTTGGAAGTACGGGGAACGCTCGGCCGACGTGGCGAATG
CTCCACCCAGCTGTTGTTCACTTGCACCGGTGCCTACATGACGCTTGGGTGTTTACGGTAATGGTATCATCGATGGGTCGACAGTTTCCCCAGCTTTGCG
CGCCACTGGTTGCCTTCCGGTACGATCGGTAGCCCCAAACGCAATACGGAGCTTCTTCTTCCATTTCTGCAATTCGGCTCCAGCGGCCGATGGTGACAAG
TCTTTCAGGATCACATCCGAAGGGTACGTCTGCGTTTCCAAGCCCATCGCAGTCAGGAGGGAGACCGTATCCTCCGCGACTTGACGAGTACTCGTTGAGT
TCACTGGCCACGCGATTTCGCTGCTAATGTCCGCCCAGACAGCTTGGCGGACAGGTCTCGGCGCAAACATCGGTATCCAAGTGCTTTCTGTTCACATCAG
TTCGAGGCATCGGCCGAGGACCTTGTTAGCGATTGGATTATCTCCGTTGATCGGTGGACGATTGCCTCGCGGCATCGCCGAGTTCACGTCCGCTCTCGCA
GGCATTTTCTCTTCATCATCTTCATCATCATCATATGCTGGTTCGGGTCCTGCGACCGCGTCCAGCTCATCCGCGAGATTCCTCGTTATCGACCGCAGCC
CTCCGCTGTGCGTCGCCGTCAATCTCGCGTCTTCCGGGGAATTGGGCGTCACCATCGCTGGTTCTCCCGCCTTCTCCTCCAGGTCATCATAGGCTTCAAC
ATCTTCACCGTTGGTGTCAAGATCACCCGCTGAGTCTTCGAAGCTGACCGAGCGCTCGGCAATTCCTGCCATGCGCGGAGTCACCGATATCGAACTCGAA
AGCTCGTTACGGCCGCCGCCGGACTTCATCGGGGTAGCTGGTACCGCTGTTGATCCTTTCACCATTTTCTTCTTCTTCCACACTTGGGTTTTGCTCGTAC
TTTGATTGTCTGTAAACAAGTCACAACACACAGAAGGTCACACCAATCCCGGGTCGCGGCACCAGTTGTCGTGTAGGAACACGCCAGAATTATGTCTGCT
AGTACTCCCACCCACAACACATACCTCGCCCTTGAAGACGAGGTGAATATCGGGCGAAATCTCGACCTGAAGGCCTTGATTCAGCCCTAGCACCGGGTTG
GTTAATGACCCTGCGCACTCCGAATTGTCGGTAGGACAACCAATCAATACAACAGCACTAGCCACGAGCACAGGCTAGTCTGCAACACACACTAAGTCAA
ACCTCGCTGGCCCTCAGAAGGAAGGGTCCAGGACTTTTCAGCCGGTAAGCGAGGGGGCCGGAGCAAGGCTCCGGTAGGTAGATAGATAGGAGGCTTCTGT
AGCACTCCTAGGTCGAACGAGCTCTCTCGTTCTCTGCAGCACGCAGCAAATCAATCACACAATCTCTACTTCTTGGACTTGCCGGGCGGATGAACACTTG
AGTTATCAGCTCACGAGTCCACCGGCAGGCATAATCCTGGCGATCAAGCGGGACCAGACACTACGGACACTTACCGTAGCCGGACTTGACTCTTGTGCGA
TCGGGAGGAAAATCTGCTCTGTTTGTTGCGCCCTGCGGGCGCTTATCGCTATACTATGGTTTCCTATATCTCAATACAAATATCTAGTGTGAACTCGTCC
GTTGGGAAACTCCTGGATTCCTGACGACTGCTCAGCGAGGTCTCAGGAGGCGTATCCGGCATATCTTCCGGATGCGACTTCTCTTCAAAGGGCACGACTC
GGATATCTTCCCTGACATGACTCCTCGTCAGGCCGTAGTGTGCCGTACATCACCTCGCTCTTGTGCCTTGTCATTCTGCCGCGGGTCTTCTAGGCCAATC
AACGCCCTGTCGTACACTTCCCCCAACGGGATTCTGACGACCAGACCTCGAAAGCAACGGCGGCAACAGCGACGGCAGCTCCGATCAATTCACTACACCA
CATACTACTCATACTGTTTTACTTTCAACTCTATCCTTCACCTCTACACACACACACACACACACACACACACACACACACACACACACACACACACACA
CACTCCATTCATTCATTCATTCATTCATTCATCCATCCATCGAACCCCATACTACTCATACGTATCCACCCATAACCTTCTTTTTTTTCTTCACACACAT
ACACATATGCGGCGTTCATCTACCTCATCCCTCTCCCCTCCACCTTCACACGAACTCCTCATTCAACTACATCAACTATACCCCCCCCCCCCCCCCCCCC
CGCCCCCTTCAACACATACTTTTCGTACTTGTCCACTCTCAATTCTTTCTCCTCCTTCCCACTACTCTTTCTCCTCAACCTTTACGGATAAACTCCTCAT
TTGCCCACCCTCAACTATACCCCCACGCCATTGCAACATGTACTATCTATACAAACCGCCTCTCCACACGCACACACTTCTCATTCACCCACCTTCAACT
CTTTTCCCTCCATCTCCATGCACACCACTCCTCACTCATCCGCCTTCCCCTCCAGCTTCACACACGTGCTACTTATACTTTTCCACCCTCCACATTTTCT
TCTCCATACACACACACACCATTCACCAACACTCAATACTCAACTATTCCCCCTTCCAAAGGACAGAGAGGCAAGTCTTTGACACACGCGAGTCGGTGCA
TTCCATTCGTCATATGTATACACATGGATTCCCAAGTTTTCAGCTACTCCAGACGATGGTAGTTTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTC
GAGGTTTATGCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGCCCCCCGAACATGATAAATTGACCGAAAATGGTCGCGGA
GTTTTCATATAGGAAACCCGAGCCAAAAATGGGAGGACACTCACCTCGGAGAGACCCGGAGCGTTCATACAGGAAAGCCGAGCCAATAAATGGAGGACAC
GGAGCACCGGCCTACCCTTCTCCGGTTTGTCTTGATTTCACTATACTGTCCTCTCGTGTATAGGGACCCTAAACCCTTATAGTGGTTTAGCGGTTTAGCG
GTTTAATAAACCCTAGCGGTTCACGGTAGTACAGTATCATCTCCAGAAAATAATACCCTTTTCATCCGATTGATCATTTCTGACGGGTTATAAGGTTTAA
GGATTACTTTTTTCATATCTGGCATATTTTTTGGGTACCCAAAATATTATTTTCAAATACCCAAAATACCTTAATTGGGGTTCCTGGGGACCCGGATGAA
TGGTTTGGGGACCCGGATGCCTAAAAAAACTGGGGGGTTTGGGGACCCAGGATGAACGTTCATCCGCGCGTCAATATATATATAGTACCGTACCATCCCC
AGAATATAATACCCTTGCGAATCGGATCGAATTTGTAGCGCTCGTCATACTGGTTTGCGTCAAATGTCAAATCATTCCAGAACGACGCGCCTTGGGGTAA
CGACCGTTTCGATTCGCGCGCGCAGACATGGGTCGCTTGATCTGGTCCACGGGGCACTCGAAAGCCACAACTACCAGCATGTCTCTCTGTCGGTGAAAGC
GCAAGTAGCGCTCGATGTCTTCGCTGCAAACGCTGGTATTACTGATAATCCCGATATCCACGCATGTATCCCAATGCTTATTAATCTCTGCGTAGGACTC
GATATTGCACCATTCGTGTGCATCGCCGAGTTGTCCAGTATCAAACACGAGGCGATCTGGTATTCCCGTTCGCGGCTGCGCCGTCCGGTCTGTACCCATC
AGAAACCAAGTGGGAGAGAAGATGATCCGGGATGCAGCCACGTGGGTCACCCGTCAACGGGCGTCTATTCATAGGGTGATGAGTATTTAATATTTATCTT
GGCCGTTTAGTGATTTATCAAACCCTAGCGGTTTTCCCGCAGTACCGTATTATCTTCAGCAAATAATACCCTTCTAATCTGAGTCAAACATGTTTGACAT
GTTATAAGTTTTAAGGTCCACATGTTGTGTTTTACATATTTTAGTTACCCAAATATTATTCGAAAATGCCCAAAAGAACTTAATTTGGGTTTATGGAGAC
CCAAATAAACGTTATTGAGACCCGTATGCCTTCTGCGAACCACCGTACAACGTCTTCAGGTGCGTCCACGCAATCCACGCTTCCTCGCAGTCGTCGACCA
CATGGTGGTAGTCCGCGTCCATGTGGAGCAACATCAGTCCGAACGCGATGTTGCTCGATATGACGTACTCGTCCTTGGGCCGCGAGTCCGTGAAGCTCGG
CGTCGTCTCTCGGTTCACGACATGCCACACCGACTTGGTCAAGAACACGCCACGCATGTAGCGGTTCCACGTCGCGTAGTTGTCTCCGTTGAACTTGTCG
ATGGAGACCTTGGTGGAGGCGTCGTGGGCAGAGGACATGGTGCTTGGGCTCATAACCTGATGGAAGGTATGGATCTTGGACACCGAAGCTTGACGGAGCG
GAGGGAGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCG
CTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTACTTCAGCCAATGAGAGAGCGCCACGTCGAAGCC
CATCTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATCGACAGTGGCGTAATCGTCAGTGGCGTAATCGGCGTGGGTTCGGATTGGACCAGTTCGGG
TTAACCGGTTTACGGTCAACAACCGATACCAAACCGGTAACCCTCCATACCCTCCATAAAAATACCCTTTAAAAAATTCCCTGTCAAATCAGTGCATCGT
TTTTGACGGGATATAAAGTTTCTTACAACTTTAAAGTAGCATACTTGTCAAAACCGATCAAACATGTTTGACAGTTTTATTTGTTTCAAAAGTTTTTTTG
TCCATGTGGACGCTATAATAGTTGATACGACCGTGGTAACTGATATCAGGTATGCCATGATATTAATGTCCACTGGTGCCCAGCCACTTACAAATTTGCC
AGGATCAACGTTAAACCGGGCTTCAATAGATAGGGTTTCAAGTAAAATTGCTCGCTAATTGTAGTTTAGCCTCCACCGGGTATTTACGTTAATATTAACC
AATCGCATTAAAGCAGCCACCATATAGCCTCCACCGGATTTCATATCAAACATGCTGTTTAAATGTCATTTATGCCAGTTAACTGTCATTTAGCCTCCAC
CGGATTCCAGTGCAGGGCGTGTAGTCTGTATACAGGTTTATCAAACCCTAGCAGTTTCTCCGTCGTACCGTACCATCTCCAGAAATGTATACTCGTCGAA
TCCGATCAATCATTTTGGACAGGTTATAAGTTTTAAGATGTTTTTTTTTTATATTTGACGTGTTTTTTTGTTGCCCAATTTTTTTTGAAAAGGCCCAAAA
TATTTTTATTTGGGTTCCTGGGGCCCGGATAAATGTTTAGGGGACCTGAATGCCCAAAATACTGATGGGGCCCACTATAAACGTTTATTGGGGCGTTAAT
ATATATAGGTCAAGAAGTTCACACCCAGTGAGAGAAACACCAACGCGAGATCGTAGCCACTCAAACGCCGACGTTGCCACTTCAACAGTCCACGCTCATC
ATCACTTCCCTCGAAAGGGTAGCCGAAGTGCACACCCAATTGCACTAGGATAGCGCTCTTGAAGGCCTTGTCGACGTACACGTATCCGGGACCTTGCGCA
ACAAGAAGCATGTTCTCGTGCTCGCGGACGCTTGAACCGAGACCAAAGGTCAACTTGGACAGGTACGGCAGTACAACGCACGGACCCGTCACCTCGAGGT
AGTCGATGTCCAAGTCTTCTTCGCCGAACAAACGGTACGCTGGTTGTCCGGGAGTCGGGGGTGCGTCGGTCATTGGCTCGTCGGCCGTGGGAGCTCCATC
GTAGATGTCGAGGATCGAGGGCGACGACGATGACGACGACGGGGAAGCAACGGCTGGCGGAATCGGGTGTCGAGCGGGCGAAGGCTGCGGCACCGGGTCG
GGCTGAAGACCGGGGCGAGGAGGAGTCGATCTCGGCTCTTCTTGGCGGGCGCATGCTGCACTGAAGAACCTCTCTTTCGAGTTCGGGTTCATCTTGGCTC
GAAAGATAAGAAGTGAGCAGCTCAGACCGATAGTCCCAAAGAAGATCAAGGTGAATGCAAACTAGCCCCAGACACCATGCGTAGGACAGTGTCCTACCCG
GGCACATAATCACGAAGGTTCAAGAAGCCACTACTGACCAATGAGAGGGTCGAAGGATTCCACGTAGTAAAATCCAGTACGAAAATCCAGTTGTGTACCC
ACGTGTGCCGTGCGCTTACAGCATCCTACAATCATATTTTGCTAGCGGGCGCAATCCAGATCACACCATCATGAAGTCAGCTATCATGAAGTCATATTTT
AAAACGGTGACTACTACTCCAGACATTTCTTACTATTTCCAGATTGCTACGGCTTCTGTCAATTCCAGCCAAAACCTATAACTGTTGACGTACTACAAAA
TTGACAAAACACGTATCATTTTTTGCAAAAAAATGGACTTTTTATTGTGAACTAAAAAAGTACATTTTCCAATATCATACTCATAATGACCGCGCTGACG
AGTAGCTTTCGAAACGGCAAGTTGAAGAAGAAAATTAAAAGATTTTTTTAACGTTTCTAAGTGTCGACGTAACCGCATCAGCTTGCTACTCCAGGATTGG
GGGGGCGGCTGGCGTAGATTAAGGAGGGAGGGATATGAAAGAAGTTTATATCGATAATCTTAAACAGTTTAGTAGACACTATAGTACAGTTAAGCCCAGA
TAATTACCTATCAAAATTGCCGGATGTTCGTATGGCTTGTACGAGTTGATAGCCTGAGGCCAGTAATAAACAGACAACGACTAATAAAGCCGGCAACGCA
AAACCCGGCATGCAACAGTGGCACGTCTTCATCTTCTATACTATTTTTTTTATTATTTTAGCCAATAGATTCCAGGAATTTTCTTTTTAAATACCAATCA
CAAAACTTCCGCTAATGAGTGGCTCAGACAAAACGATCGTAAAGCTGCATTAAAACACTGCATTTCAAAACATGCCTCGACGCAAGCAAAATAGCTACAC
AGTGAAGGAGAAACAGGGCTGCGTCCTGCTTGCACGGGATGTAGGGGTTGAGGAGGCGGCACGCGTCCTCGGGTATCCCCGAGGCTCCGTTTTCACCTGG
AACAAGCAAGCCGAGAGCCTTCTGGACTTCCGTGGCCCGAAGACCTCGAAGACTCTCAAGGGCCAGGGACGCAAGGAGATATTTCCTAGCGTCTCTGCCG
TTGTCACCTTCATGAAGGACGTAAGGCGCGACGAAAAGGTAATATTTATTAGTTTTATTCTGGCAATTCTTCCACTTTAACGTTTGTGTTTATATTTGGT
TTTACAATATTGTTCTATAGGTTCTATCAACAAATGCTATTATTGACCGGATGTGCGCAGAGGACCCCGAATGGGTTACGGAGTACATTGCTAGCAGGAA
ATGTGGTGTCCTTGCGCTAGAGCGCCTCCGCCAGCGCCTCGCAAATCGGTAAGCCATTTGGTTTTATTATTATCCATAAAGAATTGATTTTTAGTGTTGT
TTATATAATTTATAGACACGGGTTTTCATCACAGAAGCCCCAAAGCGCCAAGAAATCGCTGGAGGAGCTCCAGATGGTTCGGGCCGAGTTTGCCCTTTCG
TTTTGGTCACGGTACACTGAGTATCCGAGTGGTGGTATACTCAATGTTGATGAGACCGGCATCAACTTTGATATGCCACCACTCCGCGCCTGGGCTTTGA
ATGGCCGTAAAGATCCCGCTAACATCATCGGGCTCAAGAAGCACACGGGAAGGATGACTGCAGTACTCACGACTCGCGCAGACGGTAAGCTTTGTTTTTT
AAACTGCTGATATGTTTTATTTTGTTTCGTAATATTCGTTTTTATTAATTTAACTTGTTGATTGTAGGTGCAAAACTCCCTATTCTCTTCATTGTGCGCG
GTAAACCCGGGGGTCGTATTGAGAAGAAGGAGATCTCAAAGTACCCAGATGGCCACTTCTACATCGTGCAGGAGAACGCATGCATGGATGATTTAGGCTG
GAAATTTTATGTAGAAAAGCTTTTAAAATATGAAATTACAGAGCCTTCCGTCCTCCTCCTGGACAACTTTGAGTCCCACGTTTCGGAGGAGGGACAGCGA
CTTGTCGCTGAGGTTGCTAACGCTACAACGGTCCCATTACCGCCCAACAGTACGTCGGTATGCCAACCACTTGATGTTGGCGTAATGGGACCGCTGAAGG
CGGCCATTCGTGGTGCATCAATAAAGGCAAGCCCGAAGAGAGGCGTATGCGTGTGATAAAGGCAACAATTGCTGCCTGGGAGAAGTTAGATATGGAGGTG
GTAAAACGTAGCTTCGAGAAGGTTATTCCTCGCCACCCAGAGATAATGATCTAACAAGTCATCCTTTTCTTTGAATTCTTGGACTTTTTATTGTATTTTT
TTTCACAAGCATGTACTGTTTTATCCAATCAAAACACTTAATTTTTTGTGCCGAGTTTTTCAGTCGGATGCAGTATTTGTACGATAGTATGGCGGATGGC
GTTCAGCAGCGCCGGCTTTTTTAGTCGTTGTCTGTACTCAAAGTTAAATTACTTTTGCTGATAATTAACCGGGTTAGCTGATCCAATATTTTGCCTTCGT
GAAAATCTGGACGACGGTAATTATGGCTCGCACCAAGCAAAATGCAAGGAAGAGTACCAGAGGGAAAACAAAAGAAGACAGCTGTCAGGTAGGGCTAAGT
ACCAGTATGTGGACAAGGTCACTAGTGATGGAGATTACGTCACAACAGTTAAGAAACCACAATGCGCCAAAATTATCAACCGCCGCGAAACCAATCATGG
CACCAAGTATCAAGTCTTCTGGGTCAACAAGAACGTCACGATCCGGAAGTATTACCTCCATTCATGGGAACCGAAGAAGCAGCTATTGGAAGACGGCTTC
GACAGGTAGCTTGATGTCATCGACAGCTGGAAGAAAAGGACGATCTATGATCGCGACTCATCTGCGTGGGCTCGCCAGAGGACCAATAGCTGATTGGTTC
TAGCGTTTCTGGGCGATGCGTGTTCGAGGCTTTCAAGGTGGCAGCTTCATTGGCTGGACACCCGGACATTGTGACAGATGCGGACATCGAGTCATTTGCA
GCCGATACACTTATGAAGTACAGCATTGACATCAACCAGGACACCAAGTGGGTATGTTTCTCGTTTTCCTACGCAACGCTGGTTGAGACTTCGTCTTCAA
CGCGATAAGTTTGAACAATTTCGCTCCATTGTAGAGCGCGCGTGCTTGGTAAAGTCGCTGCGTACAACCACAGCTGGGTGGGCCACTTCTTCGTGCTCAA
GATAGAACTGAAACAGTTGACTGTGTACGACAATGTTAAGTGTTTGGCTGCGGAAGATGAAGAAGTGGACTGGGACAACTTTATCTCCTTTATTCGTCCG
TTTAGTAGATGACTGGAGTCGGTAGGAATTTCCGCGGGTTTGTCTTACCGGTAATGAATTCTCCCTAGCAAATATTGCCTTTGTGCATGAATACTTGACC
AAGGAAACCTCAGTGTCGCGAAAACCTTGTGAGAATAAGCTAAGTTTTAATGACGATACCGTCCGTGACCATGCAAATATGATAAGTGACAATAAAGGTA
TCGTAAAAGAATATGAAGATATTGTGCGGGATGTTAAAAAACGCAATGAACATGAAAATACTGTAAGTACAGGTAAAATACCGTTTCAGGTACGATAAAA
TAGAGTAAAGGAAGGTATTGAATATATAAACTACTTTGTTTTTGCTGATATACAGAGTTGCCAATAGACGCCCTTCTGGCTCGGGTTCGAGGCTAGTAGG
TGCTAGCCACTGACTGTCCAGACGGGCACGGTCCTGTCTTATGAATCCCGTACGAGGATCCGCGACTAGACAACGCGTCGTAGAGGTCGTGGCATACGTG
ACAGTCGTCTACCTCGTCGGGGTTCGATTTCGGTTCTGCAGCAGCCAAATCGGCTTAGGTGGACATGTTTTGAGTTAGTAGGTCACGGCAGGCTGAACGG
GAGTGCAAGGAGCCTTTAAAGGCGTGGTGAGAGCGGCGGTATCTGCGATTTGGTGTAGCGGTGTGTAGATACAAGTTTGTGTCGATTTGTGGAATGAAGG
GGTTGAGCGTTTCATTGTCGTCTATTGGTTAGGATGCAAACTTCACACGCTTGAGATCGAGGGTTCGACCCCCTCCTCTGATATCTCCTTTGCCCCCATC
CGCCCTTCCCCTCTTTTGCCTTGCTTGCTGCTGCCGAAACTATTGCAGCCCTTCAGGTGCGTCCTGCAAATATATGGTGATAATTTGCTTGTACTACTTA
TCGGTAATGCCGTACAGTACGTATCTAGGGTGAGTGGCTCCCGATGCGGTGGTAGTCATTGCCCATTAGTAGCTCGCCACTCAGTTTGTCATACTCCATC
CAGGATTGGCGTACGGCGAGTACATTGACCACACAACTTGAGAAAATTTCTGAACCCGTGCGCATGCCGGATACTCACTACTCACTGTAGGGTACATTGT
AGCCTCGATCCTCTGCAAAGGAGATCCAAATCACAGCTCATTTTACGAAACCTGTCCAGCGACCTGGTGGGACACTCACAGCAACGGTGATTCCTCTTTA
AGACAAAAATAGTATTAAGCACGGTAGCAAGCGTTGCTGCAGTACCATGGTCCGTCTACAGGTCTAGGGCCTGACCCTGCTCATAGACGACTTCGACTAA
GCCGGGCGACGATTGTCGCTACAGGAATTCATGAACGTTAAAGCACTACCACCCGTTGCGACAAAAACTAAGTTATCATTGGCAAGAATTGGAGTACTAA
AAGAGACAGCAAATATGATTGGCTATTGAATCCACACCCGTCTAGACAAAAGGCAACTCAAACAGCAGCTTGCGAGGGGGGAAATCGCAATGTCGGTGAA
CCCGTTTAGCGCCACGCCGGGGGCTTTCAAGATCTTCTTGGCCTGGACGATATTCTTGGCCTGGAGGACGACGATGAAGACCTTCTGGGGCACGAACCCT
GTGTGTACCCCTGTCGAGGGAGGTAACGCACGTCGAAGGGGCGGATCTCGTCCAGGAAAGAGTGCAAACAAAGAGCAAGACTATCAGGCGTAAGCTGCAT
GTGCTGGACTAGTTGGTTTAGTGCTGAATAACGCCTTGATCATTGCATGCAGTGTTTTTTCCTCTTGTAGACGTTGTTGGGCTTGATTAATCAGAAGCTG
CTCTTTCAGAGCATCCACCTAGTAGCTCAACGACTTGGGATAGCTTTTCTTGAGTCTTTACGGCACAGTACTGCATAGATAGCTCCTCTTTATCCCGCTT
TGTTGCCTTCACACTTGTGGACGGTCGCTTCGCTGCCGTGATGCTAGTTGGCGAAGACGTCGCCGAAGTCATGTTCCCTCTGGACAGCTCTGGCTGTGGC
TTTATCTCCGAGGGTTTATGTTTGCCTGACCGCGGACTCTCAACGAGCTTATCAAGCGCTTGCTCGATCTTAGGGCACTTCGAGAGCACATCATAACACG
CGACGTACGCGAAATGATGCTTGTTGCGCTCGTAATACAGCACCAACGTCTTCTTCATGGTGTCCCGCTCTGTCGACTCTGACTAAATATAGCTATTGTC
GGGGTATTGTCGCAACGGGTGGTAGTGCTCTTATGCTGGACCGCGTTAGCCGGGGACCGAACAGCGTCATGAACTTCATTGATGACTTGGTGGGTCATTT
CGCGCAAGTGGACGTGAACGGGGACGGCACCGTGGAATGGCGAACAAACTTAATCTCGACTAAAAAAAAGCGTTATTTCAAGTAACCCGCAAAACAGAGT
CGTTTCGCGTAAACCAAGTCGAGAAATACTAAGCCATGAGTTTGTAGAACTTAGTTGCAAGTGAAGTAAACATATGGGGGGACAATAGAAAAGGTATTGA
CAGGTAGTTATCAAGTCCATAAGAACTAGTCGTATGACTGAATATGCACGTGAAAGCTGCTACAGAGCAAAAGACGACCATGTTCAAGCTATTTCAGCGG
CAAAGTGATGTACACCATAGTTCTTGCAAAGGTATTTCCCGGATATGGACCTGTCAGCTGAAATTTCCCGGAATGTGGACCTTTCCCGGAATGTGGACCT
ACGTCGCCCAGATCTAGGTGGAGCACACTACGTCAGTCACTCTTAGCCGTAAGGAGAGCGTAGTGGTTCGTTGGGCGCGCGCCGCAGAAGCTAGCGGAGC
AGCTTGGAGAGCAGCACCGAGAACAACACGGCATTCCCCACCATGTTGGTGAGCGCGTACTCGTCGGCGGCCACGTTGACCAGGGTGCTGCTGTCGCCTG
CATGACCATGAGCGCGGACACGGTGACCAGCGCGCTGTGGACGCTTGCATGACCATGGCCACGTTGGCGCGTGCGAGCAGGTTGAGGGTCGTGAAGGCAG
GGATATGCCGTCGACGAATGCGAAGGACACCGACGTCGGATCTGCAATATCGCAACGACTGAAGTCTTGAAATCTTACGTCTCCATCAAACACAACCGGC
TGTGGCTGCGGAAGCCCAACTATACATACAATGAGATGATGTCGGCGGTTGAGATTGTCTATTTTAAACAGCATTCTCGATTTATTCTCTGGTCGTACCG
GTACGTTCATTGCTATTCATGCTGTCACTAACAAAACTTCTTACCATTGCGCAAGCGGCCTCTCAAATGGAGTTGCGAAATGTGGGGCTCCAGCAAACGC
GTCTGTCGATATAAGAAGGCGACGCGAAAGGCTGCCACTGACTTTCTAAAGGACTGTAGCTACGATATCGACAAGAGCATACACTTGGCGAAAACATGCA
GAAACGGAGGGAAGAAAGCGGTGTACGTGTTCTCTGACGATCGTTGTGGTTGGCGTGTTTGACACGAAGTATTCCTGGTTTTTCTGTGACGCCCGCCATC
GCGACGCTGGTCTAAAATTTCGAGCATGGATACTATTGGATGAAATGGAAAATGTGACTCAGCTGTACCCGTGCGACACGGGTGACGTATGAAGTGCGAC
TGATTTATGGAAAGATCTTACGCCTAACCACAGATGGGCCCAACTGGCTGGAAGTGTGTATCCTGGATGTGTACAAATCCACGATTGCAAACCCGCATTA
TGTCCAGCCCCCGGACTTTCCCTTACGATGAGTGCCTAAATCCTGGCGGAAAGTGCAGTTGAGAACGTATCTCAGACTGTACCTCATTTTGCTGTGGTTC
AGAGCGACTACTAAAGATACTGAACCAAGATCATCCACTACCAACACCCAAGTCGTGCGCTGGAAGCCCAAAGAGTCTGGATGTCAAGTACATCCTGAAT
CCTGAATCCTGAATCCAAAATCCTGACTCCAGAATACCAGAATCTTGACGGTTGACCACTGACTATTGACTTCGAAGACAGTGGTACGTCATCAAGTGAA
ACGCAATTGAACTACCGCCAAGGAACCCAACAGAACTGTCGAGTCGACACTTTTGAAGCTACGAAGACAATGTACCCAGACCATACTGAAGCAAAGACAA
GGTGACCAAATCCATAGTGAAATCAAGATAAATCACCCAGAGCCGAGATCTAGAAAGAATTGATAGTTTAGGGCTTACAGCCAACAACAGAGTTTGTTTT
ACCCCGTAGTGCGCAAGTGAATTCGGCCAAGCCTGCCGACGGAAATCCGGAGGACCCGAGACTACGACCGCGATACAACAAGGGGCGCTGCGACCATTAA
GGACGGGTCGTCTGTGGCATCTCCACCTCATAACATCAAGGCCAGTTAGGTGGTGACGAGAGGCGCTCCGGCACCCTGGGTTGACCCACCTATTTCATAT
CCTAGTTGGGTCGCTAGCGTGCTGGTGTTTGCCCATTTCATATTCCCTTGCTATTCGAGGTGACTGACTAGCAGTTGTCCCCCGAAGTGATAGTTTAACT
GCTGTGTGTATCGACTGACTATAGTATTTGATAGTTTCTCTCTTAATTGAGAGTGGTGCGCGTTTTATACGAGTGTTCAGACTGACTAGGTGTCTGAATT
GTAAGACTCGAGTGAGCCTAGCGAGTGACCCACCGTCCAAGGGTCGATAAGAATAAGTGACGGCTATTTGTATTGTATAGAACTCTGTATTTGTTGGCTA
TTGGTATTTGGGGTGCATCCTGGGTAAAGGTGCATCCTGGATTCCGATACTCTGGGTGTGAAATCCAGACTACACTCTGGCTTTCTGTCGTTGAGGGTGC
ATCCTGAAGTGGACGTAAGCTCGGCACAACTTCAAGGCCACAAGCTCGGTGCCGTTTCGTCAAAGACAAACGAGCCGACAGGGATTCCGCAAGGTACCCA
CGCCACCAAGAACCCAAGGTTTTGCTTCGCGGTGAGATCTTGGATACTTGTTGACTCCTACAAGTCTTCCCCCTTCAGTCCTGGAGGAGGAATTCCTGGA
GCGCGCTATACGACCCCCCCCCCACCCCCCTGGGCGGTAAAGGTTTCATCGACCTCGCCACATGTTCACTTGAACAGACGAGATATTGGTAACAAGAAGA
CGGTTTTTTTTCTTTTTCTATCTCCACAACGTTCCCTCCGATCTATGCGCATCCTTTCGAAAGACTACAAAACGCCAGTTGCTGTGCAGCACGACGTTTT
CAAGAATTTTTGCAGCTAATAGAATAATTCCACGGAGGCAACTCCAGAGTTTTCTATCAGAACGGGATGGTATCAACATTGTCGCTTTACGCTTCCTTCT
ATACAGAGCCAAAGATGCAGTCTTAGAAAGCTTTGATGTCGAATGGGCACAGTCATTTACACTGACACCTGCTGAAATTGCTTGAAGCTAAAAAGACCAG
AACTCGCGTTGCGTTGGATCTAGATTCAGATGGTCTATTTTTTCGTGCGTTCGTAGCTTTGGGAGCTGCTATTGATTGTTTTGTGGTATGCCTTCCTATG
TACGGCTTTGATGGAACTCACTCAAAGAATAACAAGTACCGCATCATCAGAATAACGTTACTGGGTCGAGATGGCAACGGTAATAATCTTACAATTGCTT
TTGCAGTCGTAAACTCAGAAAATGAAAATAACATACAGTGGTTTTTCAAAAACTGCGCACACTCTGGAGTTGTATTCGACAAAATTCCTCTCTTTTGCGA
TCGAGGTCACATTGGCGGCGCATCGCAAGAGCTGGCGGTGAATGAAATTCGTCTGAACCGTAAATTTGATCAATCCACACCATCCGCAACGTGCATATAG
AATTCAAGCATCACGGAAAAGCTGTAGAGAATGCAATATTATGTGTGCAGGGTGCTTCTACAAAAGCAAAATATGAAGCAGCTTTAGACACGCTTGAAGG
TTCCTTCAGGAAAATACTCGCGATTACATAGAAATAATTGCTCCTATCCAATGGTGTTTGTGGGCCAACAAAACTGTGACCAATTCGCCAACGTTCATGA
CATACGATCAGTTTGTGCCATGCGCGCTATTTGACTGGAGATCGACAAATTTCGTCGAGAGTGACAATAACGTCATGTAGACCTACGGC