Description :
From Genome Similarity Track
Location :
Scaffold_1973:27- 2151
Sequence
2124 bases(100 bases per row)
TCCTCTGTCACGCGATCATCGTCCTGCAACGGTCTGCCCCCTGATCTAAGAGTATCTACGAGGGCCGCCCCCGGATCAGGGCTCATTGTCTCCGGTTCGC
TTGTTGGATCGGGAGGACACGTCGACTGATCGACGATCGGGGATATCTGGCATCTCTGGAGGATAGTTCGGGGCGTTGAATAAATCGGTCGCTCGACGGC
AGGTACCGGAGGTCCCGTTGGCGCCTCCTGGTTCGTCGGCCGGTCATCTGTTGTGGCTTAAAAGGCTAGATTCTGCCATTCCATTTATCGACGAGATCCG
ATCGACACATATCCTGGAATCCGGGGTATCCGATCTCCAGCCAGCCACATCCTGATCCGTTCATTCCGGTGCAAGACGAGGTCTTTGTCGCTGATGTCGG
TAACCTGGAGATATCTGATCCTGCCGGGTCCTCGGACCACGATTGGCACCCAACGATCTCCACGGGTGACCCATAGCTTTTCTCGATCCGTCACCTTCAT
TCGCAGCGGAAGCTCGATCGAATCCCCGATCGCGATGTGCATTCCCTGATCCACACACACGTGTCGGACAATGTCGTTGTACAGTTGACGCCGTCCGCTA
AGCTGGATCTTGACTTCGTCGGGGAGACAGATAGAGCCGTCCGCAAGATCGAGGCGGATCCCCGCTGGAACCATAAAGTTCATACCCAGGATCGCTTCTT
GTCCTGATAGATCGCCGACCCAGGTATCGAAGAAATACACCAGCGATCCCGCCAGCGTAACCTTGATCCTGGTCCTTCCTTCCGTCATGTACACGCTTTC
GCCAATCCCCACACATTCCTGGCTCTGACTCGTGTCGACACAGCACCCCACCTTACGAACAAAGGCGGTGTCCACGATGGACACCTCGGCGCCGGTGTCA
AAGAGTAAGATCGACTTTTCATTGTTGATCTTGCCAGTGATCTTGGCCTGACGGAACCACTTACCTGGCGAATGATGTTTCCAGTACCCTCTGGACTCCC
CAGGGAGGAGATCGGGCACCACATCGCCAGATCTGCGGTGTTCGCTGACGCGACGCCGACTTCGATCGCGATCATGCTCCGGGATCTCGGTCGTCACTTC
TCCATCAGCTGGCGTGAACCATTCTTCCGGTCTGCGTTGCTTCCAATAGCCCCGCGTTTCTCCAGACTGGAGATCCAAGGGCACTTCGGCGTCAGAACGG
CTGAAGTCGTCCGATCGATGTAGACTTAAGACCTTGGCGGTAGATTTCGCATGCAGATCACATGTATTACCGCGTAGATCAGTCCGTCCACTTACTCGAT
CTACCGTGTTCTTGTTCACGAATGCATAGAAGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCCAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCG
GCGATCGCGGGCAACATGCCAGCGTGCTTCACCGGGTTGAACCATTGACGGATCTGGTTGTAGAATTCCTCCATCGGACACTTGCCCATCTCGTGTAGTT
CACCACATCCACGGCACACAAACAGGCAGCGATCCGCCGGATGACCTTTCTTGCCACACTTCTCGCACGTCAAACGTCTCCAACAATCGAGATCGGTGTG
TTTCCGCGATCCACAATGTGAGCAGCGGTTTGATCGCTCCGATCCGTCAGGTGAAGATCGCGATCGTGGATCCGATCGAGGTGGGTCATGGTTGATCTGC
GCCTGGTTGCTTCGATCCGGCTTCGTCGCGTCGCCCCCAGCGTTGCGGGACTTGTCCTCGGCCGACGCTAGGTAAACGCGACGTAGATCACCCTCCGAGT
CCGATCCGTCTGATCCCGTGTCCGATTCAGACTCCTGGCTCGCGATCTGCACTGCACGCACTGCCCGCTTGGTTGCAGCAGCTGGTGCTGAGGTCGGAAC
GTTCTGACGGTACTTCGATCCAAAGGCAGATCGCTTCTGTCTGCTCTTCGCGCGCTCTTGAGCGCGCAGGACTTCCTCCAGATCTTCTGCGTCCGCAAGC
CGGAGTAGAGTGAGCCGATCGGCCAGTTCCGGATCGCCCAGCGTCTCGATAAAGTGTTCGACATGTTCTCGACGGGCCTTGGAATCCCCGTCCTTGATCT
TCAAGCTTACACGCAGAGCCGCCA