Description :
From Genome Similarity Track
Location :
Scaffold_798:27- 1777
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_798-fgenesh-gene-0.0Novel protein

Sequence
1750 bases(100 bases per row)
GAAACTAAGTTAGTGAGCAGCTGAACCCACTTCATCACTAATCAAATGTGAAATTTATATCTGTTTCGATCACTTATCTTCTTCACTATTGAGCTCGCCT
TGTTCATCTGCAGGTTTCACATTTGATCAGAATGTGAATGACTGGTGTAGTTTAGGCTTCTGTAAATCATCTGTCCTATTTAAAGAACGTCGGATCTCTC
AAAGTTCGATCTGACGAAGTGAGAAGACTGCGAGACGTCGTACTCGCGACCTTTTCTCGTGAAGCTCAGAGCGAAAGAGATGAAGGAGCTGACGGAGTCG
AAAGACATGGAACAAAGTGACCGCGAGTGGCGTCAGATGCGGCGCACGCTCTCCAAACTGGAGTTTGAGCCTGTGCCGGAGACTCCTGCGCTGCTTCCGC
GGTCGCTTTACGGCAAGAACGCAAATGACGAAGAGATCGAGCCGACGACGGGGCGAAACGCAGAAGACGACGATCTGCAGAACTCGAACCACCAAGAGTC
GCCCACCAGCAAGAAGAGCGCCATCACGATGAACGCCACAGCGTACGTGTTCCGTTCATCAAGACATGCACGTTGTCATTGAAGTTGCATTCACTCCATC
GTGATATTTGTGTAGAGACAGCAGCACCCTTGAAGAGGGAGGAGTAAGCAGCTTAAGTCCAGCGCACCTAGTGACGCAGGTCTCCTTCGAATTGTTGTCT
ACCTCCATGTCAGTCTTCGCGCCTCTTCCTCCTCCGGTCCTTGCTCCTCCTGCGCCAGTTGCCATGCTAAAATCCCCAGTTGCCTCGTGGAGAGCAAAGA
AGCCGATGATGCACAGTGCCGCAAGCGCTGGAGCTACTGCTATTTCGAGTGCAGCTTCTATTGCTGGTGTATGTGCTGATACTGACGAAGACCAAGAGAT
CGGCAACATTGAAGCCCACGTGGCTGCTGCGCAGGAAGCCATTCGCCAGTCTGTGATGGTGCGTTCGTTCCCTGTGACCTGTGTGATAAGAGATATGTGT
GTGCATGCTAAAATAGTACATCATTGTATTGGGAAACGGTGCAGACTGCGATCAAGGACGTCAAGGCGAAACTGGTGCGTGAGAGCAACTTGGAGCGCAT
GAAGCTGTCGGCCGCGCACGCGAACAACGTCGCGATGCTGCAGCACAAGATCGAGGAGCTCAAGACGCTCATGGCACAAACGGACGAGAGTCAGAGCCAC
CAGAGCGCGGTGCTGGAGCGATATTCGGTGTTCACGTCCAAGCGTGCGCGCCAGAGTGTACGCATGGCTGTCATTGCTTTTCTCCTCTTTCAAGACGATT
GAGTTAGACTTAGCTAACATTGTAATGTCTGGCTTTATCAACATTGTGAATGAGCAGCGCCTCGTTTGGTCGAAAACGCACTCGGTCTCCTCCTGCTTCC
AAACGTGGAAGGCTCTGCGAAAGGCGAACAGGAGCATGAAGCACGCCCAGCAGATTGTGACCCGCCATCACCGAAAGCACATGCAGAAAACGCACTTCCA
GGCGTGGAAGACCGTCTCTCAGCAGTCTCAATTTCTACAACGAGTCCACAATTTGCAAGAGGGGCACGAGCACCGCCTGGTAGATACAGTCAATGAGTAC
CAACGCAAGATTCAGCAGGTACGATGCAATGGTGATACGAAAAAACTCCCTGCTATCAGATCATTTAGAATTAAGCCTGTGAGTCTGCTTTTTCTGGCTT
GACAGCTTCAACAGGAGCTGGAAGAGTCCAAACGCCAGATCACTATCTCG