Description :
From Genome Similarity Track
Location :
Scaffold_816:27- 1735
Sequence
1708 bases(100 bases per row)
CTGGCGATGAACAGCCGTGGCCACTTCGGGTCCGCGTAGGCGTGCTTAAAGTCTCCAAGTAGACTTTGACGTGGACGTCCCGGTCCGCTGCTGCCAGAAT
CGCTTTGCCCAGCTCGTCCTCCGCCACGGAGCGGACGGCCACGTGCAGCGTGTTCAGGGCCCCGTTGACGCACTCCAGTAGAGTGGACTGTAGGGTGGCG
CGCGGTGGCTGGGTGGGATTCTCCCCTGCATCAGTAGGGGCGTCCTTCCTCGGCGGGTGGAAGACCACGTCGACGAGCAGATCGTCCTCCGGACGAGGGG
GGTCGACGGGTGCAGGGTGCGGCCCGGGGCGGCGCGGCTCGAGGTCGTGTCGGCCCTTCCACAGACCCGTCATCGTTCCTTGGCTACGGTGGAAGTGCTC
GGCAACGTCTTTGAACGGGACGGCGGCCTTGCCGTAGGTGTCGTCGATGTAGTGCACGATCTCGAGCCGCTGCGAGCGATGAGCCACTTGCAACGCGGCA
GTTCTCCGCGCCGCTGCCTCGTTGCCGAGGTGCCACCCACGCATGGTGGGGCTGTGTGCCGAGGGGCGCGACTGGCGGCGCGCGCTGCCAGGGCTGTCGG
AGCCGTCAGAGCTGCTCATGCTCACGTCGTCCGCTATCTTCGCGCGCGCTTGACATCCTTCTCTTCCTCGATATACTGGGGGGGAGTGAAATTTAACAAC
AACGAAATTTAACAACAATGTGGTGTCGACCAGCTGAAGGTATCCGATAGTGAACGAGGATTTGTGTCTGGACTTTCGTAGTTGCATGAAAGCCTCGTTG
CTAGTACTTAGTACACTTTAGTCGGTGTCGGAGGAGCTATCTAAGGTAGAGGGGACAAAATCTCGTCGGAGAGCTCTTCGCCGCCGGCGAGCACTTTCAT
CCACCTGCCTGTCAAATGCCTGAAGATAATCGACCTCGTTCACTGATAGGCGGCGATAATAATCTGAAGCTCTCGCGAGTAGTTCACGGGCTGATAAACG
TGGTGTGGCAGCAGCACTTGGAGTTCGGGAGTGGCGACGAGCTTCCCGGGATTGCATGGCTGTAGACACAGTTTCTGAGTCCGTACGGGTGGAGTGTCGA
TGGTGAGGGACTTCTGAGCGTTCGTGAACCCGCTCACTGCGATGCGCACGGTGGCGACTTTGGCGAGTAGTAGAGTGTCTTTCTCTATGAGATCCGCTTC
TAGACGTCGAAGTAGTCGAACTCGCTGTGCTGTTCGCACCAGTTGTCGCAGTCGCTGGGCTCGGAGGTGGGAGGTCCGGCAACCCGAGCACAGAGCGTTC
AGCACGATGCAGCTCTACAAGCTTCGCCACGTCACGGTTTGCATGGACTGATGCATTAGGCGAACGGCAAAAGCCACAAAACAAACTCCGCCTCCGTGCT
TGGCTCCATGCATCGGACGAGAAGGTCTTGCCGCAAGCATTCGGTCACGACGGGGTCCTCAAACAGTTCCAGCGAGATGGGGCATGTCAGCACTGCCTCA
CGCTCCATGAGTTGTCGCCTGCTCACATCCTGCTGAGTTCTAGCTGCGTCACTCGCATGCTGCAACAACTGGGCTCGCTCTTGATCAAACGCGCTACGCT
GCTCATTCAGCCGGTTGCTCAAGTCTTCTCCAGGTGTTGCAACCTGGATTGCAGGTGTAGGGTCAAGGAAGCTCTCCGAACAGCTATTGCCGCGTTCATA
CGCCTCCA