Description :
From Genome Similarity Track
Location :
Scaffold_2129:27- 1449
Transcript NameFunction/comments
Phypl_g14713hypothetical protein

Sequence
1422 bases(100 bases per row)
GTCTTCTCTCGGCCCAAGTGGTCACTGGTGGCGCATCGTGTGCCTCCTGAAGTATATCGTGCTTCAAATCCTCGTCGTTCGGAACAACGACACGAGAAGG
ATCACCTAGCTCCACGCGATAGTGGAGCAGGCCATCAGTCCGCTCATACCGGTGGAGGTGGGACCGCCACCGCGGCGATAACCTGTCAGCCTTGGCATCC
TTGCCGGCGGTCAGATACCGAACTAGAGGCgcgagcacctcgtcctATCGATACGCCATGCGTATCCGATCATACAGATCCGAAGCGACCCGACTGGTGT
GAGCGAGTTCATAGTCGGGTCTGCGCGACAACGCATTGGCAAGCACGTTGAGCTTGCCCGGCTTTTACTCGCCGCGGAAGGTGTATTCCGCGAAAAAGGA
CCGTCAGCGCGCCATCCGCTGCGACAGATGCGGCGAGTTGATGGCCGTCCGCAAGGACGCGTGGTCCGTGTAGACCACAAAGGGCCTCGGCCCCAAGGAG
GTGCACCCTAAACTTGACAAAGGCGTACTTCATAGCCAGGAGCCCCTTGTCGTAGACAGGGTAGTTCCGCTCGGCAGCCTTAAGGTGCCTGGACTAGAAC
GAGATAATACGCTCGTGTCCATCCTCGTCATTCTGCAACAGTGCGCAGCCGATTGCATAGTCAGAAACGTCATAGACGACGCTGAATGGCTTCGCCTCGT
CCGGCAACGCCAGGACTCGCGCGCGCAGTAAACTCGCCTTGATGATGTCAAACGCATCCTGGTGATGAGGCTCCCATCGCCAGTCGATGTCCTTCTTCAG
AAGGTCCGACAGAGGCTTCGCCAGGCCGGTGTAGCCCACACTGTACTTGTGCAGATAATTCGCCAGGCCCAACCACCGACGAAGGTCCTTGTGAGACCAA
GGAGTAGTTCAAGACGCGGtgaccttggccttctccggATTCGCTCGGACTCCAATGCTGCTGACGATGCAGTCGAGGCCCTTTGTCGCCTCTGCGGTAA
ATACGCACTTGTCGATGTTGGCATAGAGCTGGTTAGTTCTTATGACATCAAACCTGGCCGTCCTCGGCACGGCTATGGACGAAGATGTCGTCAATGTACG
TCTGTGCGAGCGCACGCAACGGTCGGAGCAACTGCGTGACCGAGCGACTGAACGTCGCTGGGGCGTTCGGCATGACGAGTCACTCCCAGAGCATACCGCT
GAGAGTGCTTGCCGCGGTGAGCGGGATGTCACTCTAGCGCATCAGGATCTGGTAGTATCCGTCAATCAGATCCGTTGCGCTGTAAAGTGTGCAGCCGGCC
AGGTTGTCCAACAACACATTCTATCGAGGAATGAGCGTTTGGGCTGACACCGTAGTGTTGTTCAGCTTGTTATAAGCATGAACCATGCGTCACTCCCTGT
TCGGTTTCCGAACGCAGAAGGT