Description :
From Genome Similarity Track
Location :
Scaffold_3173:27- 1267
Sequence
1240 bases(100 bases per row)
GTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCG
CCCTGATTCCCGGCCTGGGCAGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGT
CCTGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTTCCGCCCTGGCTGAAC
CGGAATGAGAGAGTTCCACTTCCAGCGTGGGAGCGATTCCTCCCAGGAGCAACGGTTCGGCGGAAAGCGAACAGCTCCTCGTGAAGTGGAGGGGGTTATG
CCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGAATGGACTGCCCGAGAGGCTGTGGCAATCTGGGGAAACAGGAAGGCGGCGGGCAGCTTC
ATAAGGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGAT
GTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGCTCC
CATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAGGAACTCCATGTGGGACAGTTCTCGGGCATAACCCAGGGGT
ATCCGCAAACAGGATAGAGACCACCCCGGGTCTTGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTTGCGCGAGAAGCACACACCG
AGTAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGCCCGCCCACAAGGCCACGAGGAGCG
ACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGGCAGCTCCCTGGCTGACGGGTGCCGCCACC
GAACCCCCACACACACGCTGGGCAGCTTGGAATTCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCCTCCTCCT
CTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAA