Description :
From Genome Similarity Track
Location :
contig_184:26998- 30015
Transcript NameFunction/comments
g14632.t1hypothetical protein

Sequence
3017 bases(100 bases per row)
TTCCACGCCGAACTTCTCCGCGAGTCGTTGAATATACGCTCGCTGATTCATGACGATGGTCTTGTCGTCGCGGTTGCGGTGGATCTCGATGCCGAGACAG
TACTTCAGCTCACCGAGCTCCTTGATGCTGAACTCGCGCTTCAGCGCCTTCTTGATCTCACCGATCTCCGCTTTCGTCCTGCTGAAGATCATGAGGTCGT
CCACGTAGACGATAATGATGCTGAACTTCGAGTCCGAACGCCGAACATACACACACGGATCCGCCGCTGACCGATGGAAACCTTGGCCCTCCAGGTGCTT
GTTCAGCTTGCTGTTCCATTGGCGTGCCGCTTGCTTCGTGCCGTAAAGCGCTTGCATCAACAGGCACTTCTTGGTTGGGTTGACTTGGTCTTCAAATCCG
TCCGGCTGGTCCATATAGAGCTCCTCTTCAACGTCGCCGTAGAGAAACGCGGTGTCCACATCCACATTTTCAGCCTCCATGTCTTCCTCTGCTGCAATCG
CCACCGCCGTGTTGATGGACTCCTTGCGTGCTACAGGAGCGAAAGTCTCCGTGTAGTCGACCCCTGGACGTTGCGTGAAGCCCTTCGCCACGAGACGAGC
CTTGAACTTGATGATCTTCCCGCTCGGGTCACGCTTGATACGGAACACCCACTTGCACCCGATCGCCTTCTTGTCTGACGGCATGTCCACCAACTTCCAG
GTGCGGTGATCCTCAAGCGACTTCATTTCGCTTTCCATGGCGCGCAGCCATTCGTCCTTGTACTTGCTCCGCATGACTTCATCGTACGACACCGCGCGCT
CACCGTCGTCGTCTTCGGTGAGGAAGCAGTAGAGGGAATCGAACTCAGCCTCGTAGTCGTCCAGGTTGAACTCACCCCTTCGAGTCCCGGGAAATTCGTC
TTGGTAGCGCACGACTCCACGCCTTTTGCGTGCCGGACGCACCATCCACTCCTCTTCGCCGTCTCTCCCTGGCGTGCTAGAGCCACGCGTTGGCACAGAT
CCGGTCGGTCCGCTGTGCTCCTCGGGTTCGTGGAGTGGGCGTGTCGGGGGCGTGCTGAAACCGTCGTCAACACTGGGTTCTTCGGTGCGCTCCTCTTCTT
CATCGTTGTCGATGATGTCGATCACCTCCTGGTTGCGCGTCTTCGCCATTGTGACCGGTGGCGCTTCAGCAAACGTCACACTCCTTGAAATCACGATCGA
TCCGTCGCTGGGGTCCAGGAGTCGATATGCTTTGTGTTGCTTGGCGTAGCCGAGAAACACGCACTTGATCCCCGAGTTGTCCAGCTTTTTGCGTTTCTGC
TTGGTCACATGGGCGTAGCACTCGGTCCCAAAAACGCGCATGTGCTCCAGACGTGGCGCCCTCTTGAAAACCAGCTGGAATGGGCTTGCGTGTGGGCTTG
ACGTGTTAGGCAACACGTTCCGAATGTCTGCAGCTGTCATGATGGCCTCGCACCAGTACGACTTGTCCATCCCGCTCTCCCCAGCATGCAGCGTGTCATT
TCGACCAGCGTACGGTTCATCCGCTCTGCCATGCCGTTCTGTTGCGGGTTGTAAGGCACCGTGAACTCTTGCTTGATGGTCTTCTCGTCGCACAGAGCCA
CCATCCCCGCGTTGCAGTATTCACCGCCGTTGTCACTGCGTAGCACCTTGACCTTGATGCCCGCACTTGTTTCTGCCTCCTTGAGAAACTTCTTGAACGC
CTCACACACTTCGCTCTTCTTGCGCAGTGGGTAGATTGTCACAAAGCGACTCTTCATCATGATGAAGCTCACAATGTACTTGTAGCCCGACTTGGATGCA
GGAGTGACGGGCCCCAACACATCAGAGCACACAGTGGTGTCCTTGCGTGCGCTCTCCCTGGCTTCGAGTCCCTCCTTGGTCGACTTGAAAGGCTTGCGTG
CCTGCTTCGCAGTCGCACACACGCCACACACGGTTCCAGGCTCTGCCAGCGCACCCTTGAGTTTCCCGTCCTTGATCATGGAGTTCAGCGTGCCGAAAGA
CGCGTGGCCGAGTCGCCGGTGCCACAAATCCATATTGTCTTCAGCCGCATGGCACTCGTCGCCGCCCTCAATGTTGAGGAACATCAGCTTGCCTTGCTTC
CTGCCCGTCGCCACCACTTGGCCGCCGCGTTTCACAACGCACTGCTCGCTGTCCATAGTCACGGTCATGCCGCGTGCCGTTGCAGCCGTGAGAGAGAACA
GGTTCTTGTTCAAATCTTGAACGTGCAGTGTGTTTTCCAGTCGCGCGTTTATCCACGCACTACCAGTCCAGACACGCAGAACAACTGTTCCAACCCCGAG
AATCTTCAAGCTCGCGCTGCTCTTTGCGCTCGATATGGTGCGCGCAGTCTTTACACCCGAGTACTCTTGAAACGCGTCGCGTGTCTTGCACATGTGTGCC
GAAGCACCGCTGTCCATCACCCAGCACTCGCTAGCAAAAGCTTCCGTCGCATGGAACGCAACGTTCGACTGGTCTTGGACATCTTCATCGGGACTTGCCT
CGGAACGGCAATCCCTCGCATAGTGGCCAGGCTTGCCACAGTTGAAACACTTCCCGAAGGGCCCCTTCTTGCGCATCCCGCGTGCGTTCTTCTTCTTCTG
CTGCTGCTTCCCATTGCCCTTGCCGGCAAGAAGCGCAGTCGCCTCTTCGATGCGGTTCGAGTCCTTCTGACGCACTTCTTCCGCAATCAGCTTGCTCACC
AGGTCTGCAAGCTTGAACTCACTCACTGACATGCGAAACGCTTGAACCAGAGCCTCGTAGCTCGATGGCAGACTCCGCAGCATCGTCGCGCAGACGTCTT
CCTCAGTTGGCTCACACCCCGCGTTCTTCATCTCCATCACGAGCTTCTCCAACTCCGTCACGTGCTTGCCGACGGAGGACGCCGTGAACTTGAACGCCGA
GAACTTTTCCTTGAGCCACAGCCGGTTCGCCATGTCTTGAGTCTTGTGGAACTTCTTCAACGTGTCCCACGCCTCCTTCGCAGTCGTGGACGTCACCACG
TGCATCAACTGCGAGTC