Description :
From Genome Similarity Track
Location :
Scaffold_3:2699208- 2701143
Sequence
1935 bases(100 bases per row)
ACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCT
TAGCCAATGAGCGACATGTATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGACGAAGTCAGAAACATAAA
ACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTTA
AACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGGGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGCCCA
ACGACCGACTACCTGAGTTTGTACGTCACCGCACGAACGCGGAGCTGAGAAACTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCGTGCA
ACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGAGGCTCTCCAACGACTGTCAACAGTCATTGGTGAGACGGCTGTTGCTACGA
TGCTGCGTACGCTAACGCCGACAGAGCAACACGGCGTTGCTCTGGGTTTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACTACCACGGTGTCGTCCGG
GACGACACCACGCGCGCAATCGCTAAAGCTCAATGTGAGTAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCC
ATTGCGGCTCGACGTATCATCAACCCGTTGTCGAAGGTTGAGTTCGCCATGTTATGTCTTGGCGGACGTGCTAGAAGTTGGGCGTATGGACGCCGACTCT
CTGATCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAAGAGCTCAGACAAGCGTTTGAGCCACCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCT
CGACCTGCAGCAGGGCAAGCATGATGCCCATGCTTTTGAAGGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGA
AGCTGCAATTACTCTTGAAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACACGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACG
GGAGGCCCAGAACCCATGGATCTCTCGAGTGCTGCAACTGCTGGACCCCAGCAGTCGCAGAGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGGTC
ACTTTGCTCGGGAGTGCACGGCCCCCGTGCGCCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACACTGGACGCCAGTA
GGCGCGGGGCGCCCTACTGGTAATGCCGTTCCGCGTGCCGACCTTGGACACGCGACACTGAGGACCGCAGCCCCCAGTGAGGTTCATTCTCACTGCAAGA
ACCAAGATGACAAGCCTGACCTTGTCATCCTGAATGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGATAGATTCTAGCGCGTCGAAGAACTT
TGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTATAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACC
GAGAAGCGCATGGTACGCGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGTATTGGCATGCCGTGGCTTGCACGGCATGATCCGGTCATCGA
TTTGGAGAAGCGCACTCTCGTTCGTTTCGGTCGCGACAGCGAAACAGTGAGCGATGGACCTGTTGCCGCTACGCACGCACCGACAGGTGCGCGCGACTCC
CCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGA