Description :
From Genome Similarity Track
Location :
Scaffold_3:269906- 271662
Transcript NameFunction/comments
Albla_Nc14005320myosinlike protein putative

Sequence
1756 bases(100 bases per row)
ATCAAAGCATACTTGTCAGTGGAGAATCTGGCGCTGGAAAAACTGAAACTACAAAAATTTTGATGTCTCATTTGGCAGCAGTGAGTCCTAAGTTACCAAT
TTCTAGTACAAATGACACTGCAAGAAACGTCATAGAACGAGTATTACAATCGAACCTGCTCATGGAGTCTTTTGGAAATGCAAAGACATCACGAAATGAC
AATAGCAGCCGTTTCGGGAAGTTTACAGAGCTGCACTTCAATGCGTCGGGGCAGCTGGTGGGTGCTCAGTCGAGCACTCATTTACTTGAAAAGTCTCGAG
TTTCTTTCCAAAGACCGGGAGAGCAAAATTATCATATATTTTATCAGCTGCTCGCCTCAGGATTCGTGATAAAGTCCCAAGTACAGCTTGATGATGTCAA
ATGTGGTGACTTTCCAATGCTGCAATCAGCTCGATCATCGACTACCTCGCTTCGAGAAAAATTGCAGCTTCCTGACAGAGCAGGTGAGACTGACGAAATT
ATTGAGTCATCGAGAGGGAGCATGAACTGTACATCAACAGATCAGGCGTCTTTTAATTCAACAGTGGATTCCCTTACGACTTTGGGCATTACTCCACAAA
TACAAGTGGAGATTTTCAAGATTTTATCGGCCATTATGTATTTGTCCTGTCTCAAATTCATAAGTTCTGGAGGCGATAACGACGAGTGTTTTCTGGATTC
CAGCGATTTCATTTCAACAAGAGGTGGCATTCGTGCATCCCAGCTACTGGAGGTTGGAGAATGTGATCTCACGACTGCTTTAACAGCTCACGAATTATCA
TTAACTGCTGTTCCTGAGACATATACAGTTCGTTTAAATGCCGAACAAGCCATCAAAGTTCGAAATTCCATCGCTACAACTCTTTACTCTCATCTCTTCC
GGTGGCTGGTCAATCGCGTCAATACCTCGACAAGTCGCATACACAGTGAAGTGGCTGTAAACAAAATTTGTCTACTGGACATTTTTGGCTTCGAAAACTT
GGAACAGAATTCATACGAGCAGTTTTGCATTAATTATGCGAATGAAAAGCTACAGCAAAAATTCACAGAGGATATTTTCAAGAGTATACAATTGGAATAC
ACGGAAGAGGGCTTAATATGGCCTAACGTGGCGTTTCAAGACAATTTAAACATCGTGACACTCATTGAAGGATGCTCTGGTATTCTATCTCTTCTATATG
ACGAAGGATTACGACCCAAAGGAAGTGATGGATCATTTACAAATAGACTGAGGGAAAAGTACAATGATCACGGATGCTTGATATTTCCGCGCTTTAACCG
CGACGCTTTTAGCATCAAGCATTATGCTGGTTTTGTTCTATACGAGACGGATGGGTTTTTGATGAAAAACTCGGGTGCTTTTCAAAACGATATAATGCAA
CTGGTACGACAAAGTCGCTCGTTGTTTCTGCGATCTCTATTCTCACTGAAGAAGAACGATGGCCAAGCACCAGCCCATACCAGACGGTCTCAGAGAAGGC
AAGGTGATCGAGCGCATGGCACCTGTCGACAGAGAAGCATGTCCATTGTACCTGATACAGTCGGGAATCAATTCAAGTGTCAGCTTGATGAACTTTTGGC
CGGTATTCGTAGAACGAAAGTGCATTATATCCGCTGTATCAATCCCAATGATTGCAAGAGCTCATCTATTTTCAACAAGAAGCAAACTCTGGATCAATTG
CGGTACTCTGGTGTGATAGAGGCCACACGAATCAGCCGGAATGCGTATCCAGATCG