Description :
From Genome Similarity Track
Location :
Scaffold_9:26990- 31054
Transcript NameFunction/comments
Albla_Nc14012890ATPbinding Cassette (ABC) superfamily putative
Albla_Nc14012900
Albla_Nc14012910conserved hypothetical protein
Albla_Nc14012920conserved hypothetical protein

Sequence
4064 bases(100 bases per row)
TACATCCGAAAATTATTCGTTCATTTGATTCCATGCATTCGGGACGCGCAAATACACGTTGCGGTCGTCACATTCAGCCCACAAGTGGCACTTATTAAGG
AACTATTAGAGCTTTGCTTTGGAAGTGCGTTAGCGCAATCGATTATTGTGCGTGGAGACGACTCGTCGTGTTTATTGACAAGTTTGGGAGCCCAAGCATT
TGACCCTTTCCATCCAGACAAAGCTCTATATTTCGATCGAAGATGCAAGTTGCGATACATTGCATCTGCTGCGACAGAAGCATCGATGACGTGCTGTCAG
CCTATACAAACTCGCCATACTGTTTTGATCGACGACGATCCTGCCAATGTTCGCATCGCCAAGGACACAGGTGTGGCGGGAATTTATTTCGAAGTGAATG
ATACAACCCTGACGAACCTGTGCGAGCGTATAAAGCAGCTGCATGTCGCCTCGCCAACGATCACATACGCAACTCCATTGAAAACTAGGACCAGAACAAT
GTCACGATCGTTCTCAACACCGGATATTGGTGCGAAAGAACGACGATTTCCCTATTCTAAGAAGAATATCCTGTACACACCCTCGCCAGCGCTGAAAATC
AAGTACACTGTCGACATGGGACGCCCAAAGTCGAAACGAGCAGCAAGAGCAGCGACGCTTCCTCGAAAGATTTATTCCTAGAATTGAATATACAAACCAC
GAATGAAATAATACCCACATACCTTCCTCTTTACACATCATACTTTCGAGGCCAACCCACGTATTTAGTAGAGATACTATCAGACATATCAGCTGAGTGT
AGGTTTCACAAGCTTTCGAAAGAGCGATGGATGACGTGTACTATTCGAATCAACAAATGCTTCTGTCGCCAGTTCCATATATCCCCTTCTGACGAGTTTA
TCGTGCAAGGTGGAGCACGCATAATCGCCAAATACTTCTACATTTCCTTTTAGAAAACACTGTCGAGTTATATCTCTTCATTACCCATTCGATAGAGACG
TAAACTTCGACTTGTGGTCGTAATATGTCACATCTATGAGCAAGTCATCATGGAATCGCACGCTTCACATGCTTCATAAGGGAAAGAAGGCACCGTTGAG
AGTGTCGCATGTTGTGAAAAGCTACTTTTCAAATGCGCAGGTGACTCGAAACCTATTCTTCTACAAAAAAGGCGTATTATCAGCTGCATGATGGCATCTA
CGTTCGACATTTTCTGGCCTTGGGTAAAAAAAGAGGATGAATTACTGATTATGCTAATCAAGTCGATTTCTAGTTACCTATGTCCAAAGTCCTAATGTGG
GACTTTTTTCTTGTGACGCCCGTATTGCTCTACGTCATTTAACAACTTTCACCCACTGGATGTGTTTGAATTACGCATAAGGTTTCACTATACTTTAACG
CAGCGTGGAGATGGGGAATAACAAAGGGATGGTAGAAGCCCATCACGACTCGAACGTCCATTCACAGTTCCAAACTAAGACCTCATCATGCAACTCCTCC
TCGTGGTATCCATCTGATCCGCTGGCTAGAATGATGGAGTCAGCTTCTTCGATACATCTTGATTCGGGGTCGTCACCATCCCATACGGACTCAGTGATAG
CAAATTTCAATGATGAGTCTTTATCGACACTCAGCAATGCCACAATTTCTTACAACAATCCGAGCGTGACAAACGAGCACCAAACTCTCGGGACCTCGCA
TGAGGGCGGATGCGATAACAGCCCTCAAGCTCATGTGAAGAAAAATCGATTGTTTGAATCTTCTCGTAAAAGTATTTTGACCCAAAAAGAAGTGTTCATG
TGTCCGGAAATACATTGTGGAAAACAATTCCCTCGATCCTTTGCATTGCGTCGTCATATGCGAATCCATACTGGTATCAAGCCATATCGATGTGATTACG
AAGGGTGCACGCAGTGTTTCAATACTTCTGGCAATTTGAGTAGGCACAAGAGAATCCATAGTGGCGAGCGTCCGTACCCTTGTATTGTCCCGTCATGCGA
GAAGCGATTCAATACGAGCACGAAATTGAAGCGTCATATGCGATCGCATTTTCCCGAAGGTGAGCATCTTTTCCGGTGCATTGGGATGGACTGTACTTGG
AGCAGCGATAACTATAAGGAATATGTGCAGCACCAGAAAATCCAGCACAATATCGCCGCAAAGTACAGAACTGGTGACATGTCGATGTCCGATCAGCAAA
AGTATATGGGCTTGTATCGATACAACTCCAGCATGGCTTCGCCACTCGAACAGAATGTGTATCCTCAGCCATGTATTTCTCGCTCATACGCTTCCTCATC
ATCGACCAATGCGTACCGAACAACGGAATATGCGGAACGCGAGTCCCAGCGACCTCGTGAATCATACCATCGAGTGAGTCCGCATCTGCATGCAGCACAA
GACGAATTTTCGGTAGCCGCCGGTGATGACACGGATCGGCATTACAAGCACCAACATGACATTCTGACGGAAGAAGGTGGTATGGTGTCCACATATCATC
ACGAATCACAGCGTAAGGGACACATCCAGGAACACGATTATGAAAGTAAACGAAGAACCAAATATCACAATGTGCGCTCTCCATCGCTATCCAACCCTAT
ATCGGCGTCTGAATTCCCATTGGCATCACACGATACATACGAATTGGAACAGCATCCAACTCCGTCCACTGGACCCTCTGAGCAAACGAGTTTCTACGGA
TCTCGCTCCGGTGGATATGAGTCTTCCATATCGTACAATTCTGGTACAAACTACAATAATGAGCCATCTTCAGCGTCTCTACATCAAATAGGTCGTCTTC
GACATGATCTCAACTACACCAATGCCCCATTTTCTATGACATCAGTGTTGCAAAACCAACGTGCTCCGATGCTGGGAAGCATCCAGCATGCTCCTTTGCT
TCGCCCACCTCCACGCTCACCGACGGAAGAAAGTACTGTCAAACAAGAACACCATCAACGGTATCAACAACAGCCGTATAATAGTTATCCAGTGCCACCG
ATGCAGCCTGCGGCTCCGGAATTCACCGGAGAAGAGCTGAGTGTGGTGCTCGAGTTAATGAAATAAGTACTGAGAATCAGCATAATACGTGAAGCGGGAA
TCGAAAGCTGCATGTAAACGTATGATTGACAGTAAAATGTAATAAATGTAGGGGCTTTATTCCTCGCAATATTGTCGCAAAGGAGATGCATCGAGTCAGC
AAGTTTTGTACGTATGCTCTGATTGGCGTATAATTGTCGTAAGCGCTGACCTCAAAATACAGTTGGAAATTCACGTCAACTGTGAGGGAATCTTACTCGA
GGTTTATTGAGGGAAGCTCCTCGTACTATGCTTAAAGACTGTCCTCAGCATCAGTGGCTAGCTCTTCGTAAATTAGAGACACGACTCGCGGTGTGGTGGA
CCAAGTAATTTGGTGGATATCCCTTGCTATATCAATGACGGCTGGAAGCATGGGTAATCCATCCTGTAAGACGAGAATGCTCTCTCTTACGAGCGATGAT
CTGGGACATATCATGGACTATTTGACCATACGCGAACGCTTTTGCCTTTTACAATCCAGCAAAGCCTTGTTAGCCGAGCCACTCGCTCGGGAGTTTTATT
CGTACTGTCAGAATTGCACTCCTTGTCGAGATGGACTCCCTCATCTATGCAAGCAGAATGATCAGAATTTTTCATTTTGGAGCAGTTTGTTTCGATACAG
TGGGAAGGAGTTACACACTCTCCGAGTTGCTGTATGTGGGTCATTCAATGCTGAAGTGCTGAAAGCAGAACACTCACAGAGCACATTACAAAATTTGCGG
ACTTTGGAGCTCAATCGGTGCAAAAGTGTTGGAGCAGAAGCGGTATGTGACTCTCTCCCTCATGTATGCTGAATGTGCTTACATTTTGTGGTTAGCTGCT
GGCATTAGCGCATACGTGTCGGAAGCTTCGGGAAATATGTTTTCGTGATATGACGATAGACAGCGCGGCTTTATCGCTACTGTTTGAGAGGAATTGCAAG
TCATTACGGGTAGTCCATTTTTGGGGCTGCCATACTTTGAATGAGATGGATCTAAGGAATCTCA