Description :
From Genome Similarity Track
Location :
Scaffold_1699:2699- 7331
Transcript NameFunction/comments
Phypl_g13988hypothetical protein

Sequence
4632 bases(100 bases per row)
TGGATCGGACTCGTCGGCGTAACGAGACGCGTTCTAGGTCCGTACAACGGACGTCGGCCAAGCATGTGAAGACGGAACTCGTCTGGTAAACACACCGTTC
CATCGCCTGCATCGAGACCGATACCCGCCGGGACCATGAGATCCATTCCCAGGATCGCGTTCTGGCCCGCGAGATCACCGACCCAAGCCTAAAAAAGTAA
ACGAGGTTGCCGGCCAGGGTAACCTTCAGTCTTGTTCTTCCAACCGTGTAGTACGTCTCGTCTCTAATCCCCACACATTCTTGCGTTCTGTCTGTGTCAA
TGGGGCAGCCTACCTCACGAGCAAAGTCGGTGTCCACAATAGACACCTCGGCACCACTGTCGAGCAACAGAATAGCCGGATGATTATCCAACTTCCCTTT
GACCTTGGCCTGGCGAAACCACTTCTCAGGAGCGTGGTACTTCCAATATCCACGTTTCCCTCCGGGAAGTAGTTCCATGACCGCGATTGGAAACGCGCGT
GCAAATTCATCGTGATCTCGACGTAGACTTAACACCTTGGAGGCTAGTAGTCGGCTGAAATCACATGTATTATCGAGAGATGTAgactcctcttcctctt
gcacCGAACGCTTGTCAACAAATGCATAGACTAAACAGACCGTTCGGCTCGTACTGGTTTCCACACCATCGAGCGATCTAGTTTAACATCTGCTCCGCCG
TCGGTGGTAGCATCCCTGTGTGCTTGGACGGGTTATATCACTGACGTAAGAGGTTGAAGAACTCTTCCATCGGGcattctccagcagcatggacGTCACC
ACGCGCCTTGCAGACGCGAAGGCAGCGATCGGACGGATGACGACCGCCACATTTGGCACacgtcagcagcgtccagcagTCCGACTCAGGATGGCGTGTC
GAGTTGCAGTGAGAACACGGAGGGTGCATTGTGCGGTCCATTCTCCGTTGGATCGTCACGGCGAGACACAGCTTCGGGGCTCCGCTGGGCGGTGACACAA
AGTCTAACCCGTTCCGCATCTTCGAAGTCCTGTCCGTAGTCCCACTCGTTTTCCGGTTTGGCACTGTCACGCTGGCTGGTCCCATCTGAGACTCCGGTCT
GGACCGCATGGACGGCCCGTGGAGGCGCGGCTGGGGTCGGAGCCTTCTGGCGAAACTTGGTCGATCCGAACAGTGATTTCTTCTAGTTATCCAGATCTCG
TTGCCTCTTGCGGAGCACGGTTTCTGTAATGGGCCTTCCAACAGTTATATAAGTAGTTAGATATTACATAAGTGGTCATAGGTACACCCGGATAGCGGGT
GCAGAGNCCCCAGTCTACAGACTTGGTCTCAGTTCCCTGAGTCCTGTTgcaagcttcctcatcgctacgTGTAAGCTAGTGACGTTAACCACCTAGCCCG
TTACAGTTTCAAGGGTCAGCACATCAGGTACCATAAGCATGGTTAACTGCATGGTAAGTTCGGGCTCCTGATGGTTCAGGGTTCGCACATAGTGTTCTAC
GTGTTCGCGTTTCTGCTCCGCCGATCCTTCTATGAAGTGGAGTCCGGCGCGAAGGCCAGCCACATTCAAACGGTACAGATATTCCAACGGGGTCTCGTCC
GACCGCTTGGTCGCATGGTAATAGCGGCTTGCTATCGATACTCCTTTTCCGCAGTATTGGATCAGGAACTGGGCGGTCAGCTTCTCCCAAGACGTTCGCG
TCTCCCGGCCGAGTTGGAGGTACCATTGTCGGGCCAGACCGGTCATCAAATCACCGAAAAGACTACACACTTCACTGGGGCCCATGTCATCACGGCGGGC
GGCCGAATGGAGTCTGTTAAACCAAGAACGCGACTTCTCCTCACTGGCATCTCGGCCGCTGAACTCCTTCAGTTCCGAAAACGCCGACATCCGTACACGG
GCAAGGGAGGGTTGGCTTAttccagccgccgccgctgccgctacAGTAGGACGCCCGGCCAGTGTTCCGCCCAGATCAAAGAAATCTTCTGGATCGTCGG
ACATACCGTTCCGCTCCCGATCGGAGCTGACCATCGAACTGACGGACTCCATCGGTTCATCTTGGTCTTCACGCGGTAGCCCAGGGGATTGGAGTTTTGT
CATCGCGACTTGACGCGCTGCGTAACTCCTCATCATCTTGGCGAACGCATCTTCGATtccaggcggcgctggactggTGGACCACGTCCGGTCCCGATCG
CATTATCCGGCTTCTGGTGCCCAGATGTCGACTTCATGCGAACGGGAGTGCCGTCGCTATCATCATCGGACTCTTTGACGAGCGAAGAGACCGAATGGTA
TCGGGAGGAACCAGTTGACCCTCCGCGCGACGAATCTTCTCGGGATCGAGAGGTCCGTTCCGCGTCGGCTTTAACCGTTCCGACCAGTGTCGACAGCAAA
TCGAGTAGCTCCACAAGCATACGTTTCCATGCCTTGACGTTTCAGTCGTACACGCGTTCCATCTCAAAAACGTCTAGGGCGTATCCAGCATCCTTCAGCA
CACTGAAGGTTGCGTGCACGGCACGCCGGACGCTGGTGAGAGTGATAACGTTCGGGTCCAGAACAGGACCGGCCAGATCGCCTACTAGGGTCGGAGGAGC
TTCAGAATTGGGTCCATCCTCATCATCCCGGCTAACTCTGAGCGACACAAACTTTGTTCTAAGTCTTCAAGTGTCGACTGTGGACCAGGTTGTCCTGTGG
ACAAGGTCGGCGACCCTTCATCTTCCGACTCCGGAGCTCTCATCTTGCCGTTCGACTTGCTCGGCTTGCGCCGAtacttcttcgacttcctccGCACAGG
CTGGTCTTCGTCGGGGTTTCGTTCATCTTTAGCCTTCGCAGGCTTCGGACGGGCAGAGTCTTGACTGGAGTCATAACCCGGTGCGGCTCCGCGGGGAGCC
GCATCGGGGACAGCGAACGCTGCTTCGTacgcttcttcatcatcgctgGGGCCTCTCGGCTTACTGTGTACGTTCCCTCAGAGTCCATCAGCGCGGTGGG
TCTCATTTTGCCGAACTCAGTTGTCATCAATGACCCATCAATCGATGACCGTCGGGTCTCAGGTTCCTGCTTGATACGCATACCGTCTTCTGGACTAGTA
GTACCGGGTCGCGGCACCATTGTGGTGGAGCGGGTTCCTCGAAAACCGTTCCGCGGTCTTCTCAGTGTTATCTCCGACGCACAAACGCAGCGTCACTGTT
ATCGTGAGTAGACGTCGCGTGATTCCCCAGGACTTAGCTAACGTAATTCCAGGGACGGTGGGCGCAGTTGTTCTTGTGGGCGACGATCACGTCACCGAGG
TCTTATTGTTGGTTGTTGGCAGGCGCGGAGATGAGCTTCTCACGCCGCCGGTTGTCTtccttcgtctccttcctccgGTCTCCGCAGGACCCTATCGTTT
GTCTCTGCGGTCTCCGTTCCGGTCCGATCTGTTCACGTCAGTTCCGGTCGTATGGTCCGTTCCAGCTGAAGTCCTCTGTCTTCGTTGCACTTCGGCCCTT
TCGCTTGCCTTGGTGCTCCTTCCGTTCCGCGCCGGGAAATGCGTCCGTACGGTCCGTTCCTTGGTCGTTCTCGGGACCTATCGTTTGCCCTTGTGCGCCT
TCTCTCCGTCGGTAACTCGGCCCTTTAGCTTGCTCCTCTCCTACGTGGCTGATTTAAAGTGCCTTCCTGTCAGACACTGGTCAGAGTTGAGTACACGCAG
CCAACCGGTCGTAGCGCCCCGCGTCTCGTAGTCTGGTATGGCCGAGGTCGATTCTTCTACTTGGGGAGGTTTCCGGCTCGAAAGCGGCGAAGTCGTGGCA
ACAAATGGATATTACTTGTGCTGGTACTTGCGGGCTTGAGCTCAGATTGCGGACTGACAATCCTATTCTCCTACTTTCTCGCCTGGCCGAACCACTCCTC
TACCTCTGCCTATCTTGTCGGGGATCCGTGAGCTTCCTCGGTGATCTCCGCCATCCATCTTGGCTAACTGAGCGCGCATATGCTGCCTTGCACATTTGGG
GGTTCTGTAGACCGAGTCTAAGTACAGACTTGATCGAGTCAGCGCGCTCACAGCCGGAAAACGGAGTTTCGAGTCAAAACCGGTTTGGACCGGTTGACAC
CGGTAGTACTGGTGGAAGCAAATACCGTTCGGGCCTGGTACTGGTAGATACCGGTATGGACCGGTGATCAGATGCACGAGGGATCTGCTGGATTTGCGCA
ATGTGTGGTCCCCGCCCGACATCACATCGAAATCGTCGACCCACTTCTCCACACAACCATAACTGTAAAGCAACCTTACCTGCTGAACTACCAGAGCTTT
AGATCGATTGacacgacgagttcgaggacgaTGCCATGCTTCTTCACTCTGTCTTCCAGCTTGTCGGGTTTGCGCTGCTCGTTCCTGGCAGTCGTTATCG
CAGCTTGCATTGATCGCGTGAGATCCACTGGAATGACAAAGTTGTGCATGTAGGCTGCTGGTCGGACGGCTTCCCACCGACACTCGATTGTACGGCCTCG
CAGGTAGGCGTCTTCTAGCTGGACTGGATATCtctccgtcatctccacgaCATCCTTCACATTTGCAGTGGTTTTTGCCCATATTACTAGCTGATCTATC
GGTACAGAGAAACCACTTGGATATTTGTGGAC