Description :
From Genome Similarity Track
Location :
contig_1:269886- 272899
Transcript NameFunction/comments
g74.t1hypothetical protein
g75.t1hypothetical protein PHYSODRAFT_510564
g76.t1Ribonuclease P/MRP protein subunit POP5
g77.t1hypothetical protein PHYSODRAFT_316656

Sequence
3013 bases(100 bases per row)
AGAACCGTATCCTGGATCTGCTGCCTGACCGAGAGCGCAACAAGATCCTGCGAATGCGCTCGGGGCCGACAACCAACGAGCTGACCACTGAGATTGACGA
GCTGTCCCATTGGGCGGCCGAGATGGACCTGAAGAATGACGCCCTCATGCGACAAGCTCCGATCAACGAGAACTGCCTCCTGTGCGAGGGCAGCAAGCTC
CTGGAGATTCAGAGTCAGAGCTTGCACGTTCCCCTACGAAGATGGCTCCAGATAAATGTGACCAGAAGAAGTCCAAGGCGATCCCAGCTTACGATTTTAG
ATCGTGGGAGAAGTACGATGTTGACAAGGCTCTTGTAGAGCTCGATGAAGAGAGCGAACGAGCCAAGGAGCAGGCTCGAAAGCAGCGAGAAGAGCAAAAA
GCGTGTCGCCTCGCGAAAGCGAGAGCTGGAGTCACTTCCCAAGTCAGTTAGCTAGATATGCTCCAGCCAGAAACACGGAAAGTGTACGCGGGATACGAAA
AGCAAAAGGGCAATGACTGTTTCAAGGCCAATGAACTGGAGATGGCTCTGCTGCACTACACCCGGAGTATGGCCTACGACGACACAGACGCTATCCTCTA
TGCCAATCGTGCGTTGGTGCATCTCCGTATGAAGAACTTCGCCGCTGCTGAAGACGATTGTGCGCGCGCCATTTTGCTCGACCCTGGCTATATGAAGGGA
TGGAGTCGTCGTGGCATGACTCGCTACAGGAGGGGAAAGTACGCTGAGTCGGTACAAGACTTCAAAGAGGCTCTGCGGTTGGAGCCTGGGAATCGTGAGG
TAACAAAGCTGTTGAAAGCCGCAAAAGAGAAGCACGAAGAGGTCAATGGTGTTCTATTGAACAACGAAGACTCGCCTGTCATGGCTGAAGAAAAAACTTT
CAAGCGTTTTGAGATCATCGAGAAGGTTGAAGAAAAGCCGTTCAAGCGTTTTGAGATCATTGAGGAGGAGACGACGACATGCGTCTGAATGAACAGAAGA
ATAACCAGAACACACACGACCGGCAGCCTGATCGAGGTTCGTTTGAGAAACCTTTCACGCGTTTTGAGATCATTGAGGAGGAGAGCTCGGAAGACGAAGA
TGACGATTAGTTCCAGTGGGACTCGATGCAACAGCCGACAAACCTACTACTTTTGCCGTGCAAATCGCTTATCGAGACAACCACGAAGACCGGCACGCTT
ATTCATTGCCTAGCAAGCTGCGGCTCTCCAATGCAGCTTTGCTATAGTTCTACTCTGTTTCCATGTCGGTCGTCTGACTGTCCTGCTCTGTAGGCTGACG
CACAACGCCCAGACCTGACTTCGCCGTGGAGAGGAAGTAGGATCGTGTGTCACCGAAAGACAGCACAGCTGCCTTCACGAGCATTCCCGGCGAGAAGACC
TCCTCCATGACGAGCTTGTCAACGTCGTGGTTGCGCACGTCTTCCAGGCGAATCGTTCCGGGGAATGCCTCCTTCAGCACCGTCTCGTCCACACACAGGA
TGTCCACCATCACCTGCCGAGACGTGATCTTCACCACGCGGCAAAGGACCACGTCGCTGAGTCGCAACACCTGCGCGGATGCCACCGTTTTGTTTGCGCG
CGTGACCTCCACGACGTCCTGCGAGATGCTCCACGTGCCGCAGATGGACGCGAAGATGGCTCCGTTGTGCACATACGCCCCGCTTCCTGGCTTGAGCTTT
CCGTCCGCCGTGGCCAGGCGCTGACCGGGCACTGCGACGTCTCCTGCTGCGCTGCTCATGTCGAATCGATTTCAACTCGTCCTGAACCTTCTTATGCCGA
TATTAATCGTTTTCCATCGAATTTGGGAGGTTACACAAAGTTGCGCTCGCCATACAAAAGTCGTACGATGGTGCGTCTCAAGACTCGCTACCTCGTGGTG
GAGGCCTCTGGCGGGCGCAAGCTGGCGGTGAAGAAGGAAGACATCGCGGCGCTGATCCGTGAGTCCATCACCAAGAGTTATGGGGATTTCGGAGCTGGAT
TAGCGCAGTATGCTTTCCAAGGTCCGTGGCTATGAGTGGCTTGCTGCGACTGTATTATGAGAGCGCTGACTGGATATGTGCGTCGATGATGCTGCGCAGT
GCTATATTATAACACCCAAACCAGGCTGGCAGTCATTCGGTGCGCACGCGAGATGTGCAAGATGGTCGAGACGTCGCTGGTGTTCGTGACGGACGTACAC
AACCAAGACGTCAGCATCCGCGTGGCTCGCGTATGCGGTACGAGCAGCTCAACCGAAGGAGGTTCAATCGTGTTGCTATGTACTGATGGTTGTGCTCTTG
CTCAGGGTCGAGCCGAACGTGCAGAGAGCATTTGCTGAAGTTTTCCCTCGAGCGCGCCAAGACTCTGAATTTGTACGCTACGCAGCCTAACTTCGACGAG
GAAGTGCAAGCGGAAATCGCGCGCGTTGATCCACAGTAACGAAGCAAGGCTATTTAACGCTCAATACACACGGTCACGGGTTGTATCGCCAATATTGAAG
TACTGAGGATTACTACTACTAATATCTGCAAGCTCAGGTCATGCCCCTGAGCACCGCAAAACACACCTCCCAAACTCGTCTGTTCGCTGTATGTATTATT
TGCTGCCTGGGAGTACGTCGAGAGCAGCAAAGACCTGCCTATCGTTTCGCTTGCGTCGATCAGATAGCCGTCTATTCGATGGACTTGCCCTGCTTCTCGT
ACTCCGTCTCGATCTGCGAGCAGTGGTAATCCACCTCATCGAAGATCTCGCGCACATTCTTGCCGGGCACCTCCATCACGTGCTTGGTGCCGTTGACTGC
AACGAGAGAGCAGCAAAAAACACCAGTTAGTCCCAGCTCCGCATTCAAATGCAGCAGCCATTGGCAAACGTACTGAAGTCCAGCTTGATAATAGGCAGCG
ACCCGTCAGCGACGTCTCGTAGCCGATCTCCGCCTTAGGGTTCACCTTGCGCGTCTGCAATCAATGTGAAATCATATCAGAATGTATTTCTCCTTCCCTC
CTATACTGGCCAG