Description :
From Genome Similarity Track
Location :
Scaffold_125:26978- 29056
Transcript NameFunction/comments
Phyta_totarag4121hypothetical protein

Sequence
2078 bases(100 bases per row)
AGAACTCGCTCGTGTCTGAGATTGAGATCGAGGAGATCCTTGAAATCGCGGAAGCTGTGCGTCAAGAGTACCATGAGTCAACGTGGGCGTATCTTAAGAT
TGCTTCAACGCTGTCAATCTTCCTACACACTTCAGATAACAGTGGCTTAGCACCAATTAAGGGCCGCGCTGTTGTCTCTGCTGGGCTTAGCAGTCTTGTG
AAGGTATTCTACCCGTATATGGTAAACCAGCCTCGAGAAGAACTCACCGACAATTGGCACCCAGTGAGCAGCGTTCTAGCAGCAATGGAGCTGCCTGTTG
ATCGCCTCTACCTCATGCTGGACCCAATGTGCAagacgcttcttctcgcagtGGAGGTGTGCCGTCTATCAAATCAAGACGCCCAGGATAAAGCTGATCT
TGTTGTCTTTCCTAAAGTCACCGTCGTCTGTGATCGCGAGGATGTCTTGCAATCGAGTGTGGAGTACGTTTGGCGCAATCACCTCTCGTCTGAAAAGGTT
ACATCGAACTTCTCTCTTTTTCCGTTCTTCAAGAGTTCATTCGGTGAGAAACTTGTGGATGGAGTGATGgtcgaagaaggagaaggaaagGGTCCACTGA
AGGAATGGTTTGGACTCGTGGGCACACAGCTGGCGTCAAAATGGAAGCAACTACCGGCAAGCAGGATTTTGTCCGAGAGAGACTCGACCCAGGTAACTGT
AAGTGGGAACGTGATAACAATTCCTGGTGCTGCCGAGGTAATCCGACCAGGTTTTAGGCTCGAATGGGAGACCAGTGTAGGAGAAACGACCCATCGAGTT
GTTAACAAGAGCGTGGAGAATGACACCTTCCTACTGGATCGAAGTGTGCCATCCCATTCATTCGCGACATCTCAGCTCCGCATTTCACAACCCAGCACTG
CTATATTCGAATATGTACAAGGATCAGAGCGCTACTGGCTCAACGAAAGCACGCGTGATTCGGCCGAGACTCGGAACGTGTTGGTATTTGTAGGATGGTT
TCTCGCCAGTGCAATTTCCCACTTCAGCACGATCCAGCTACAGGTCCACCCGCTGTTCTTCCGCTTGCTGCTAAACCCTCAGCACTGTGTAACGCTGGAA
GAAATTCGACTTTTTGACCCGCAATTATTCAAGTCATTGTCGGGAATGAAAGACATGAAGCCGGGGGATTTTGCTGAGTACCTGAAGTTCGAAGGCGCCG
ACGATAGCCTGAGTGTTGATGCGTACATCGGCAAAGCGCTAGAAGAGAAGTTTGGTCCTGCGTCTGGCATCGGATGGCAACTCCAATCTGTGCGTCGCGG
GTTTACTTGTGTCATTTCCAttgagcagcttggacgGGTTGGTATCGCTGAGGCAGATCTGGTAGAGATAATTTGTGGTGGCAGTGCTGGCTGTGATGAT
TTCGTCATCAAAGAAGTCTTCCGAGTGGCCGCCGACACCGATTTCTCTAGTTGTGGGCCCCTGATGAATGCATTCTGGCAGGCAGTAAACGGTTTCGAGC
CGCAGCTCAAGCGGAAGTTCATTAAGTTTGTGACCGGTGTGGATACGCTGCCTCTGGCAGGCACCGAGGTACGCTGGCGGACTCCTCTACTGATATGGGA
TTTTAGCTGGCTAACATTGTGATCGTCCTATTACTCATTATCAGTTCTTACGAATCGAGATGCCATTTACTGCAATTTCTGCGGCTGATCACGAAAAATG
CCTGCAAATGCTTCCACAGGCTCATGTAGGTGATtgctacttcgaagtagctaTTAACGCGTGCTAGTTGATGTGATTTGCCAACCTACTTACTCGTGGT
CTCGTCTTCAGACTTGTGACAACACTCTAGAGCTACCCCATTACTGGAAGGCGTTATGCTGGAGAGAGCAGCATGACGAGCACGAATCAAGTAGCAAatt
ggaagaagagctggcaCTTTTGCTGGGTAAGAAGCTGCGAGACGCAGTGGAATACTCGAGCGGGTACGGGCTTGACGGCACGTCGGCAGTCAAAGACGTG
TTCGCGGTCAAGTCCGTagatgacgatgctgagtTGGCAAAGGAGGAGAGCTACGACTCGCTGGGTCTGCCTGCATTG