Description :
From Genome Similarity Track
Location :
Scaffold_65:269714- 272680
Sequence
2966 bases(100 bases per row)
GATAGTAGGACTAAATCGCCTTCAATAGACGAAAGAACATTTGCTCTTCAATTCTTGTCAGCGTTCCGTTTCTGCCGGTCTAGCGCGTGAGCGATGGAGT
CCTGCACGAAACGGACCACTGCTTCTCGAGCCAGCAGAAATCCTTCTGCTGGCGAGACATTGTTTTGTTCAGTTCACCTTGTGCGAACTGCAGAAAGCGT
TCTTTCCTCTTTCTGTTCGTCAGCGATGGTGTCATCATCCTCGCTGGAATAGTCATTGGCGATACTGAAGATACCAGCATCGTCATCATCATCTGACTCA
ATAATAGCGTCATCGCTAATATTGAGATGACCGTCTTCTTCGATGTAGACCTGATCGACATCGGCATCATACGTGACGACTTTAGCGTCGACACGTGATG
AGCGTGAGCCAGAACGGTTTTTACTCGAGCGAGTCCCCCCCTTATCCAATAGTCACACTCTAAGAGGGTGGGCAGACGTGGATGGCGTAAGCCATTCACG
AAGAACGTTGTGTGCTGGGTGACGCAGAATCCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCCATTCTGACCCAATCTGTTTTCGGGGATGGGTTCAGATTGTTTGACATTCTTCCAATCACGTTTCTGAGTGATTCGAAACACGGGATTGC
CAAAACTCCCACCCGTGAACCCGGAGGGGTCACGGTTGGACTCGTTGTTCACGGGGTAATCCGTGGGAGTCGAAATATCGTGTCGATAAAGACACGAGCA
CAGTCCTGTGCCGTGATCGACTCAGGTACAGCAGCAAGATGCACTATCTTGCTGACCTGGTCTACGAACACAAGAATACCATTATTCTTGTGGTCATCGT
CGGGGAAATCAAAGGCGAAGTCCATGGAAACGGACTGCCAGCACTCTGCCGAGACAGGTAGAGACTGTAAATGTGCACGGGATGAAGGACTAAGCTTCAC
TCGTTGACAAACCACGCAAGCACGAATGTACTTGCGTACAAGCTGATACTGGCGGGGCCAGTAAAAGTCACGACTTACCGCAAGGTAATTCTTCTCCCTA
CCACGATGGCCACCTGTTGGGGCATCGTGACACTCATACAATATGCGCAAGCGCAAATTGTTATGAGCGGGTACGACGACACGATGCGTGTCGCCAGCAA
CGGCTGTATAGTACAGCAAACCGTTGCGTGTTGTGTATCAATCTGATAAGGAACGGTACAAAGCCTATAAATCTGTCAACGATTTACGAGTTGGATTCAC
CAGATGATCCATCAAGCGCAGAAGATCCTTATCTTCTGCGTAGGCCTTTCTTACGTCGTCAAGTAATGTTGACGACGGGATACTGACTGTAAGTATCGCA
ACAGTGAACTTCTCCTCACTGTTGGATTGCGCGCCCGGCTCGAAATCTGTTCGGCGCGAAAGCGCATCAGCGACGGCATTCAGTCGTCCTGGTTTATAAT
CGACGGATAATTTGTACTCCGTTAAGAAAGACAGCCACGTCTCCATTCTTTGCGAGAGGTGTGGACTGTTTACGGCCGTGCGTAGTGACGCATGGTCCGT
ATAGATAACGAACGATATATCTCCCAAGAGATAGACACGAAACTTAGCCAGTGCGTATTTCATGGCAAGGAGTTCCTTTTAATGCACTGGATAATTACGC
CCAGCTTCTTGCAGCTGACGCGATTGGTAGCAGATGACGCGCTCTGCGCCATCTGTATCAAATTGCATCAACGCACAGCCGATAGCAAAATCGCTGGCGT
CACAGACCACATGGAATGGTCTGTCCTGATCTACAATCACCAGAATGGGCGATTGCATCAAGCTCTGTTTGATACCCTCAAAGGAACTCTGACAGTCAGC
GTTCCATGACCACTTCACATTTTTCTTGAGTAAACAAGAAAGATGCACAGTCATTTCGGCGTATTTGCGCGAGTACTTGTGCAAGCACGCCGCTAACCCA
AGGAACTTACTTAGTCCCTTGACATCGATTGGCACGGGCCAGTCGGTGATAGCTTTGATCATTTCGGGATCAGGGCGTACGCCGTGTTTACCCACGATGC
ACCCAAGAAGTAGTATTTCTCTAGCAGCGAATATACACTTCTTGAGGTTGTCATACAGCTTATGCTTCCGCATAAGTGTAAGAACCTGATGAAAGTGTGT
TCTATGAACCTCTACGTCCGTCTTTCCATCCATAGCCCGGCTATGGACGAACACATCGTCAAAGTAACTCGGTGCGAAATCTTGCACCGGTCTTAACTGA
TTGTTACACAACTGTTGAACGTTGCAGGGGCGTTACTCAGCCCCTGTGGCATCACTAGCCACTCCCACAGCATATCGCTGGGGGTGCTCACTGCTGTGTA
CGGGATGTCGCGTTCACGCATGAGGATCGGATAGAAGCCATCCATCAGATCCATGGACCAGAAGATGGTACTCTTTGACATACCATCAATGGTTACGTCC
TTCCTCGGTATCGGCGTCTGAGCCGGTACCGTTGTAGCATTCAACAAGTTAAATGCGTGCACTATC