Description :
From Genome Similarity Track
Location :
scaffold_37:2697- 4901
Transcript NameFunction/comments
Pl_111474hypothetical protein PHYSODRAFT_285444

Sequence
2204 bases(100 bases per row)
CCGGAGTCGCCTTTAGAGGGTCTTCTCTGCAGTGATATAGCGAAGGAGCTCGACCTAGCGTCGCATCTGCTTGACGAATGTCAAGCTGTAGTCAGTGACA
GTTGCTCTGTCATTGCGGAAGCCATTCAGTGCTCGCTTGGATTGCAAAATTCGCTAGTTTCTGAGATTGAGATCGGGGAGGTTCTAGAGATCACGGAAGC
TGTGCGTCAAGAGTACCATGACTCGACGTTTGAATATCTCAGGATTGCTACAACATTGTTAATCTTCCTGCTCAGTTCACATAACGAGACCTTGGCACCG
ATGAAGGGTAGAACAATTGTTTCTGTAGGATTCAGCCGTCTTGTGAAAGTATTCTACCCGTATCTGGTTAACCAATCCCGAGAGGAACTGAACGATAATT
GGAGCCCGGTGAGCAGCGTTTTAGCAGCAATGGGACTACCCGTTGATCGTCTCTATTTTATACTGGACCCTATGTGCAAGACACTCCTACTTGCAATGAA
ACTGTGCAGCCGATCAAATCAAGACTCCCAGGACAAAGATGATCTCGCTGTCTTCCCTAAAGTCAATGTTGTCTGTGATCGTAACGATGTATTACAATCG
AGCATGGAGTATGTTTGGCGCCACCACCTCTCGTTGGGCAAAGACATACCGAACTTCTCCCTTTTCCCATTCTTTAAGAGCTCATTTGGTGAAAAACTCG
TGGATGGAGTAAAAGTCGAAGAAGGAGAAGGAAAGGGACCGCTAAAGGAATGGTTTACACTGATTGGCATGCAACTGGCATCGAAGTGGAAGCAAATACC
GACAAATAACATTTTATCGGTGGCACACTCAACGCAAGTAACTGTGAGTGGGAATGCGATAAGAATTCCTGGTGCTGCCAAGGCCATTTATCCTGGTTTC
CAGCTCGAATGGGAGACTAGCGATGGTGATACTATTCACCGCGTTGTCAACAAAAGCGTGGAGGACGACACATTCCTACTGGATCGTAGTGTACCAGTAT
CCCATTCATTCTCAGCGTCTCAGCTGCACATTGCACAGCCTACTACTGCCATACTCGAGTATGTGCAAGGATCGGAGAGCTACTGGCTTAACGAGAACAT
GTACGATTCACCTGAGACTCGCAATATGTTGGTATTTGTAGGATGGCTCCTCGCCAGTGCCATGCTACACTTTAGCTCGATCCAGTTGAGGATACATCCT
CTATTCTTCCGCTTATTGCTAAATCCTCAGCATTGTGTGACACTGGAAGAGGTTCAATTGTTCGACCCACAGTTATTCGAGTCATTGTCGAGGATGAAAG
ACATGAAACCATCAGATTTTGCAGAGTATCTGAAGTTTGAAGGTGCCGACGCGAGTCTGACCGTTGAAGCATACATCACCAGCGTGCTACAGGAAAAATT
CGGGTCGACAGCTGCGATTGCATGGCAACTCCATTCGGTGCGTCAGGGGTTTACACGAATAATTACCGTTGCCCAGCTTGATCATGTTGGTATCGCTGAG
GCAGATCTAGTCGAGAGCATTTGTGGCAGCAATATCGGCTATGGTGAAGATTTTGTCGTCAATGAAATCTTCCGAGTTGCTGCCGACACCGAATTCACGA
GTTGTCTACCGCTAATGAATGCCTTCTGGCAAATAGTGAACAGCTTCGATCCGCAGCTAAAGAGAAAGTTCATCAAGTTTGTTACAGGAGTGGATACGCT
ACCTCTACCAGGAACTGAGGTACGCTGACATATTCCTCTGGTGATATTGCAAACTGCTCCAAACTAACGTCGCAATCTTGTTTGTTGTCTAACCACCAGT
TTCTACGAATCGAGATGCCTTTCACTGCGATCTCCCCGGATGAATACGAAAAGTGCCTCCAAATGCTCCCGCAAGCTCATGTACGTGCATTCTACTACTT
GGCGGTATTTGATGCAAAAGTTCACTTTCATCTTTCTTAAATGTAGACTTGTGACAACACGCTCGAACTGCCTCACTATTGGAAAGCGCTTTGCTGGCGA
GAGCAACATGACGAGCACGATGCCAGTACCAAACTGGAAGATGATTTAATTCTTTTGCTTGGCAAGAAGCTGCGAGACGCGGTGGAGTACTCGAGCGGAT
ACGGACTTGACAAAACATCAGCTGTCGCTGGTGTGCTTGCCGAGAAACCCTTAGATTACGACACAAAAGAGGAAAGCTACGACTCGATGGGTATCCCAGC
TTTG