Description :
From Genome Similarity Track
Location :
Scaffold_1349:2697- 4111
Transcript NameFunction/comments
Physo_109750putative polyprotein

Sequence
1414 bases(100 bases per row)
GCCATGCAGAGCGACGAGTCGTCGGAGTGGGTGAAGGCAATGAATGCGGAGCTCAAGGCACACGCGGACAACGGATCATGGACGCTGGTCCGTCGGACAC
CGAGTGCTCGACCGATCGGTTGTCGCTGGGTGTTCGCAAAGAAACGCGACGAGCACGGCCGAGTCATCAGGTATAAGGCCCGCCTGATGGCGAAAGGGTT
TAAGCCGAAGTATGGTGTGGACTTCTTTGAGACGTACTCGCCCGTGGCCAACATGAACTCGATCCGAGTGGTGTTGTCGGTTGTGGTGGCCGAGGCGTAC
ATAACCGAGCAGCTGGATGCGGACACCGCCTTTCTCAACAGCGGGCTGGTGGAGCGCGTCTACATGGAGGTGCCCTACGGAACCATCAACGCGAAGAACA
TGATGTGTCGGCTGCAGAAGGCGATCTATGGTCTGAAGCAGGCGGCGAATGCCTGGCATAAGACCATCCACCGAGTCTTGGTGGGCATCGGATTTCGGAG
CTGCGGTGGCGACCAGTGCGTATACGTCAAGGGCGAGAAGGGCAGGTTCGTATATGTCTGCCTGTACGTGGGCGACATGATCATCGCGGCCAAGACGAGC
AACGAGATCCAGGAAGTCAAGGTGGCGCTCAAGAATGCGTTTAAGATGAAGGAGTTGGGCGAAGCCAAGTTTATACTTGGTATGGAGATCGACCATGACT
CATCGGCGAAGACTCTCATGATCAAGCAGACTCGATACATTGATGATGTGGTGAAGCGGTTCAACCAGCAGGACGCCAAGGTTGTGGTGAACCCGTGCGA
GTCGGGCATGAAGTTGTCGAAGACTCAGTCGCCGACGACTCAGAAGGAACGCGAGGAAATGCAGGCGAAGCCCTACCGAGCACTCATTGGCTGTTTGTTG
TACATTACAACGTGCACCAGACCTGATGTGGCGTACATCGTGACCCAGTTGTCGCGCTTCCTCGAGAACCCTGGGCAGCAGCACTGGAAGGCTGCCATCC
GCGTGCTTAGGTACCTGAAGAGCACCCGAGACATCGGCATCGCCTACAATGGGAACGCGAAGAAGGTCGAGGTGACGGCGTACACCGACGCCGACTGGGG
CAGCAATCTCGACGACCGACGCTCGGTGTCAGGCATCATGGTGATGATTAGCGGGGAGCCGGTGGTCTTCAAGTCGAAGTACCAGCGCACGGTGGCGCTC
AGCTCGGCAGAGGCCGAGTACATGGCGCTGAGCCTGTGCACGCAGGAGGTGCTGTGGACCCGCGCCATGCTCAAGGACATGGGTCACGAGCAAGTGGGAG
CTACCCAAGTATGGGAGGACAACCAGGGCGCAATCGCCCTCGCAAGCAACGCTGGGTACAACGCGAGGACCAAGCACGTGGACATCAAGCATCACTTCAT
CCGCGAGAATGTGT