Description :
From Genome Similarity Track
Location :
Scaffold_2306:2697- 3940
Sequence
1243 bases(100 bases per row)
AGTTAGTAGTCAGTATAGGAATCGAGCTTGCTCGAGTGTGTGCATAGGACCCGCATCCCATGATAGAGAGGTGTGGAGAGAAGAGAAGAGAGGAAACACG
AGCACCATGTGAGTCGGTCTCATGCCCATAAGAATGGGATAGCCAAATGTAGGTTTAATGCCCTTCACATGCCTACTAATGTAGGTATAATGCCCTGTGC
TAGTGAAAAATGCAGCATTTTCGCACAAAAAAACGGAATGGCGACGTGGACGGAGCTCTTCGGCGACGAGCTGCAGACCAAGGACGGGCTTCGGCCGACC
GCCAGCGTGCTCGCGGACAAGAAGGTCGTCGGGATATACTTTAGCGCCCACTGGTGCCCACCGTGCCGCACATTCACACCCGTGTTCGCCACGACGTACG
AGGAGCTCACGGAAGCGCACCCGGACGTAGAGATCGTGTTCGTGTCCTCGGACCACGACGTCGCGAGCTACAACGCGTATTACGAGGAGATGCCGTTCGC
TGCGATGCCGTTTGTGAGCCGCGAGCAGAAGCAGCGGCTGAGCGAACGGTTCCATGTATTTGGCATCCCGACGCTCGTGTTTGTGGACGACACGGGCGAC
GTGATCACGAAGGACGGCCGCCAGGTGATCGACAACACCATTGGCGACGTCGAGGAGCTATACACGTACCTCACGACATGAACAAGCGTGGGGTGAACAC
AGCTTGGCGACGCGCTGCTGCGATTCGAGAGAGGGCGTGGTGGGGTGACATCGGCGCCAGATAAAGGATGACTTCGTTAAATCAGCTCAAAACCCACTTC
ATATGCGTATTCGATATATAGAGTAATTCTGAAAATTCTAGAAGCTTGATTTTATTGTGGTTGCCGTATTAAGAAGGTTTATGCGCAACAAAGAGGCCTT
TATACACCGCTTGATCGGCAATCAAGAAGAGTGACTCCTCGTCGACAGATTTCGGCTTGCTGCCCTGTCCCAATACTGGAGACCATCGCGTCATCGATTT
TCCCAACTGTGGCAACTTACAACGCGCCGCTTCTCGGCCACAAGCGCTCATTCCCAATTCCACCACCAAGCGCGCAGCTCACCAGCCACCAGCACACGCC
CAACCACCAACACAAGCGCCATGTCGTCTGCCCTGATCAACCTGCTTGGCGAGGAGCTCCTCACGAAGGACGGCGTGCAGCCGACCGCGAAGGTGCTCGC
GGACAAGAAGCTCGTCGGCCTGTACTTCAGCGCGCACTGGTGC